Description :
From Genome Similarity Track
Location :
Scaffold_2:816551- 826174
Transcript NameFunction/comments
Phyin_T30-4PITG_01326Dynein heavy chain

Sequence
9623 bases(100 bases per row)
GACCCAGTAGTTGGGTGGCTTATCACTGGGAAGCTGCACTGCTATGACGTAGTTGGTGGAGATGCCAGTGGTCGACAGCGTTCCTTGCCTCACCGACGTC
TTGTACACTGGACATGGGTACATCATGACACCTGGACTTAGTGTGGGGGAACTTGCCACCGCTGAAGTAGCAGGAAGGAAGTGGACGATGGACATGGCAG
AGAACATTTCTCCAGGCTTGGCGTCTTCAAGGAGACGACGCGACGGAGACCACTTGGCTCCTTGTAACCAGAGTCCGTCAACGTAAATGCCGTCGGTGGG
GCTCTGAGTGAGTTGCTGCGCGTTCTCGACGTCCAGGACGGTGAAGGTGAAGGCCAACGAGTCGATGGCAGTCTGATACTTTCGAGCGAAGTTCTGCAAG
GTGCCAGTCATGAATCCTTGCGGGAAGAAGAAGACGTTAAGCTGGAACACAACCGGTTCGCCATGGAGTAGCCATTGGCGGAAGAACGAGACGCGGTCGA
GTAAGTCGCGGACCCACGACGCGAGAGGCTTCAAGGACGCAAAGCCGACGGAAGACCAGAGCTGCGGGACCTTGCCGTTCAAGAAGGCAGTGTACATGTT
ATCCAGCTCTGAGGACATGACGATGAGGCCGTTGATGGCCTTCTGGATGTCTCTCAAGGACGAGCGCATACGTCGCAGCAGTGTGTTGAACTTGATGACT
TCTTGGCCCAAGACGGTGGCCAACGAGTCCATGACGACAGTCCCAGCCACGTCTCGAGTCTTGAACGTCGTGGGTCCAGCCTCTTTCACGTTGAGGTCGG
CTGGGAGGTGTTCTTGAATAGAGAGGGCCAGATCTAGAACTCGCTGATCGTTCGACTTGCCGCCGCCGCCGCCTCCGTCTCGCGGCTCGAGACTCAAGAT
CAACTGCATCATGTTGGCGCTTTCGTTGCGTTCGTATGTGACGTTGGCGTTCTCGTGCATCCCGAAGAGTTCGGGATTGTCGAAAGCTGGTAGAGCGCTG
AGATACGACTGAACACTCGAGTGCGAGAGCTCTTTGGGCACGTGATACAGACCCGACGTCGAGTACGCGTGGCCCGAAGCCAGCACGTCGGGGGTGTAAA
AGTTACTGAGTATACTCGTAAGACAGCGGCGGTCCCAGTCGTCCGTCACGCGTCCTCCGTAGTTGATCTGGCCCGTGACATACCGCAAAGCGTCCCAGGG
AATGATCGGTTGTTCCTCCAAGAACTTCCGAAGACTCGCCAGTGACGTCTCCAAGTCGGTATCGTTGAACTCGTACTTGATATTCCAGCCCAGAGCTCCG
AACTTGCGTCGCTCCTGGACGATCGCGTGGAAGAAGGTGAGTGCACAAAGCAGCGACTTCCACACGTGCTCTTTCGCCTCGCCAGAGTCAAAGCTGCCGA
GATAGCGGAAGCTCTCGAGCACTTCGTCGGACAGCAACGTGTTGAACGATCGGAGCAGGTTCGCGCGGATTCCTTTGGGCGGCTCGTTCGTGAGTTTGAT
GCCGTTTTGCAGCACTGTCACGGGGAAATACGCGGCCGGGAAACTGGTCAGGAAGAGACGGAACGTGGCTTGGCACTGCTCGTCCGTCCGCTGGCCCATA
TCTTCCACCAGTTTCTCCAGTTTGGGCATCCAGGACTTGGCCAAATGGCAGTTCTGCAGCAGCACCCAGTCGCCCGAACCTTGGCTGCTCTCGATGAGTT
TCTCGGCTCGTGGGCCTTGTCCTTGGCCCAGAGAAATGAGATGCAGACGCTCGATGAACGACATTTCCTTGGCGAATCGAAGCAGCATCCCCGTCGGATC
AGCACCCGCTGAGAGCACGAAGATGCACGGAGTCTTACGGTCTGTGTCGTTGTAGATCTCCTCCATCGTCGTCGAAGCGTTGCGACCAAACTCCGCCCCC
ATCTCGGCCGAAATCATGTTAAGCACCGACTGAGGCACTTTCTCCTCGGCTAATCCTCGCAGTAGCAACACTTTCTGGAACGCGTTTAGTACTGATCCGA
AGTTTCCGGGACAAGAATTCGGGTTTGACAGGAATTTCGGATCGTCGAGCCAAGCTAGCCAACGTGGCCAGACATTGGTCAAGGACGTACCGAGTCCTTG
GAAGGCCTGGACCTCCGTCCTCTCGCCTTCTGTAGTCTCGATATATCCAGTTACGACGGTCTCCAGTTCCGAGATCAAGTCCCATTGAGCCTCAGTGATG
TGCGACGGCTGCGGGTTTGGCTGCTGGGTCGAGCGATCGGCACCTGGTGGGGCCCCACGGAGATACAAACTCCACTCACGCGCCGATATCTTACCGGAAT
GCAGCAGGATTTTACAGCAGATGAGCATCGAGAAGAGCACTTTGTGCACTTCGAAGAGCCCTCGACAGATATTCACGTAGATGTATCGAGTCTGGAAGTC
GATGAGGTTTGTCAGCCGCTTCTGCAACGTGTCGGCCTTGGGAGCCTCGTCGAAGCAGATGTTGAATAAACGCTGGAAGAACGGCAGCGAGTACTGGTAC
ATGGGGTCGATTAGCGCGAGATTGGCGACCACAAAGTAGATAATCGACCCTCGTGTAGCCACGCAGCGGTATTCTTCTCTTGCGCGGTTGATCTCGATCT
CTGTGCTTTCAGATTCTAGAACACGCTCCTTAATGATACGAGACGTGACGTTGGATGACTGCAGCGTGTCGATGAGGTCTTGATCATCTAGAACGTTTCC
TGAAGACTCGGAGAGTTGTTTCAGGATACGGTCTTCGATTTCCTTAAGCTGTTTCTTATCCTGTGCCATCGTCACAACCAGCCGGTTCTTCTTCTCTTCA
ATATCTGGACGTTCATGACGCACCACGTCGCCTAGAAGCTGGTCTTCCAGCCCATCCATGGTCACTGTGAAGTTAATGACGGTCACCTTGATATAAACTT
CCGGAAGGTAATGCGGATTCGGAAGTTTCGTAGTCAGAAACAGCTTAAAATTGGGATCGTAGTCCACATCTGAATCGCCCAGACGGATCAACACCCGTCC
GCCTTGTTTGTAGATGGCTTTCTGTAAGATTGGCTCTAGCGACGGCTCCAGCGTCTCGTCAATATCTTCAATCAACAAGGCCTTACCGTTCCGGATACAA
GTCTCCAATGACCGCAACAAGTTGGCGTTGGTCATTTTAGTCGTTTCTAGATTTGGAAATAGGGTTTTCTTAATCCACTTGTTCGCTTGACCCTGTGGAT
CGATCATCAGCGGCCACCGCTCGCCTCGAGTCACTAAGATGGCGTTATCGGTTGACGTGGAGTCTGTGGGGAGCCCGTTCAGCTGCCATTCACGCACCTC
CACTGGGCTACCGAGTGTAGTTGAAAGACTGTAACCTGACGAGCACGGGATATGAAGTTCCTGAGTCTGAGAGACCCACTGGTCCACAATCCGCTGCCGA
AAGCCCCCCGTAAAAGGCCCGTAGTAGGAAATACAGGCCGCAGCTAGGAACGTATCCCCAATAAGCGCCAAAATCGACTCCGACAAGGACGCCACACTCT
CTTTCCAACGAGCTCCTTCAACTGACAGTCCGGAAATGAGTTTCTCAGCACGGACGAGGCGCTTTTCGGTCACCGCCGCGTCGTTTGCGAGCTTATCCTT
CTCGTCCAGAGTGTCTTTGCACTGCTTCTCCAGCATCGCCACATTCTCGTTGACGACGCGCAGTTCGTCCTGTTTTTGGCTCAGAATCGCGTTAGCTTCG
GCTAATTTCTGGTTCATCCGTTCCAGATTTTCCTTTTTCGGACCCACTTCCTTGGCCACTTTCGAGTACACGTCCATGGCGTGCACCCACATACACAGCG
ACGTCGCCGCCTTGGACACTTTGGCCACCACCTCCACGGCCATACCCGGCTCCGACACAGCCTTACTGAGTTTCTTCAAGGTCGCCGCGGGGATATTATC
CTTGTCAAAGTTCTTGAGTTTATCCAGAAACGTCACGTCGCTGAGGATTTTCTTGGCGGAGTCCCAGCTTTGCTTCTCGTTGAACAGCAGACACACCGCG
TTCATGACCGTCTCGACAGCCTCCGGAGGCTTCGCGAAGGACTTCACCTCTGTAATGTCGTTCTTGGATAGACTATCCAGAGCTTTGATCGAGTTGTTAA
GAGCCGGCATCGCCACATCCAGATCTTTCTGCGCGTCAGCCTGGACGACTGCCACTTCTTCGGCCTGCTTGGTGACTGTAGCCTCGTCCTGCGAGACACG
TTCACGTACGACTGCTGCGGCCCTTCTGGTCCACTGACACGCGCTTGAGTAATTCCTCGGCTTCGACGGCTTTTTTGGCCAGAATGGGCTGCAACTCGAT
CAATTCGGACTTTAACGAGTCCACGATGCTGTTGGTCTCCTCGAGCTTGTTGACGCCCACTTCCATGCGGCTCTTGGTCGTCTGCAACACGGCACGTTTC
TCCTGTAACATTTTCAAGTATAGTCCGATGAGATCGAGGTAACTTTTGGGCGTAGTGTACACGTATCGCTGCAGTTGCGACAGGAACTCGTCGCCGAAGT
CGTTGGACGTTGTGTGGACGATGGAGCACATGTCGACGAGCGCTGTACGCACGTCCTCCGAGGGCAAGGACACGCCGGCGAGCAGTCGATCAGCCACCGA
CTGCAGAGCTTCGCGCGGCCAGTTCATGTACCAGTCGATCGTACAGCAATTGATGAGCGACGGGAAGGCTCGACAGCGCACGCGAAGAGCTGAGCCCACT
GGCGACATGGCCAAGACAATGTGCAGATAATTGCGCACTCGCTCGATAAATGTGGCAACGCAATTGTCTCGAGTCTCGGGGATCTCTATGGCTTTAACTA
TAGGTCGCATGTCGGCGATAATGCGGTCCATTTCGTCCTGAGGGAAGAGATTGGGCACTTCTCCGCTGTTTAAAACATTGTTGATGTCTTCCAAGAAACT
CTCTTCGACAATCTGACTGTCAGTGAATAGAAAGACTGTGGACTGGCCCCCCACGCCGGCACTGATCATGAGTTTCTTGAGGTCTTCGTGGAACTCGTTG
GTGCCGTATCCGCGCGTGATCTCGATCTGAACGCACTTGGCTTCCACCATGAACGCGCCGAGACGAGCGAGCGATTGTTTCCCGCTCCCACCGACGCCAA
TGAGCATCGCGTTGCCTCGAGGTTGGCGTAGAATCCGCACCAATCTTGATAAATGCGCGATGGCGTCTCGGAAGAACACGAGGTTCATTTTATTGGCGAA
AGAAACGTTGTAATTCTCCAGGAAATCGTCCATGATCTTGGTCACTTTGGCCACATCGTTGCAGTGTTCGTACAGGGGCGTGGGCGTCCCCGGTTTGAAG
AAATCGCCGAAAGTCAGAGGACACGGAGCGTGGAAGAGCGTCTCTCGTGACCAGCTACAGTTGAAAAAACGCTGCAGTAAAGCGCACACGAGCTCTTCGA
ACCACACTTGGTCACTGGCGTTAATAAGGCGGTCTTGGAACACGCGGGAGGCCTCGTGCACCCACAAGCGGTTCATCGAGTCTGCATCGGGACATTTGGA
CGGCGTGATCATGAGAATTCCCTGGGAAACTTTCGACACGTCGCGCAGGTTAAATGTGTAGTGGAATTTATTCGGCGTGGGTAATAACTCGAGTGCCACG
CGGTTGTAGATCTCAATAACACTGGAGATTATCCCGTCTTTCATGGCCTTTACAGATGGAGCGAATTTCTCCAGAAAACCTCCAAGAATTGATGCAAAAA
TGAGCTTCAAAGACGTCTCACCTGCCGGATACATGCTCAAGACGTGGAAGTGGCGTACGAAGCGAGGGGTGCAGTGCGATCTCCCACCTCCAGCGGGCGC
CGCAGCTGCCAGTAACATGGTGTCTGCAATGTCTTTCCAGAATAATTTATCGCGGTCGTAAAATCCACCGAAATCCAGAAATTGACGCAATAATTCGATT
GGGGCTTGGGCGCCGTACTCCTCGACGGCTGGTAGGTTGACGTCGTCTACGAAGATGATCATACGCTTCCCCGCTACGGGCCCCAGTAGATTTTTACGCT
TCTTTTCGAGTTTATTCTCGATCGTCATCTGCGTCACTAGCGACGACGTTTGCGCCGAGAAATTGATGAAAATTGTCATGAAATTTGACGCTGGGGCGAA
GGAATTTTCGCCATTTTCTGCGTTATCTCCAGTTGAGATCAGGGGGCCTGACGTCAGCTCTTGCAGTAAATCCTGGACAATTACCGTCTTGCCTGTGCCT
GTGACGCCCGTGACGTATGCTGGGCGCTTGGCTGCAGTTAAAGTGCGCAACAAAAAGGTGAAGCGAACCGAGTCTGGCGTCGCGACGGTCATCTTGAAGT
ACGGAATTTGGGCATTGTACACAAATTTTGGGACCACTTCACTCCACGCGCGGAATTTGGTCTGCTCAATGTCCACAAAGTAGTCAAATACCAGCCCAGC
ATTCGGGATATTGAGCTTGGCCTCGGTCATCAACTCGCGCGCGAAGCTGTCGAACTGTTCGTGCGTGTCCATCGTCATCGTCGCCCCCACAGACCAGAAG
AGAGAGAACGCGAACACTTTGTCCAGCAGCTCGAGCATCTCGTCGCTCTTCATTTCTAAATACCTCACGCCATTCTCAGGACTGAAGAGAGACGCAAACA
AGCGACACAAACTCGTTGCCAAGTTCATATCCACCGTCGGGACCAGCTCAAAGCTCTTTCTACGCACAAATTGGATACATTTGTCCACGTAATTTGTGAT
AAGCAACTCGAGTCGCTTGAGCCCTTCAGACGGGAAATCTGACGGCAATTCCCTCTCCATCCACGTCTGGACGAACGGCATCCAGCCGAGATCCGCGGCA
GTCATGTAGACCACACCAATCCGACTCACCGTCGCAGGAGACGCCACCGCCAGATCCATGACCTCGAACAGCATTTTCATCTCGTTCTTGAGCTTAATGC
GCTCTCCATTGGCGAGACACAGCGTCATGTTGTCGTCCAGAACCGTGTTCATGTTCTCGATCCACAGGGCGTCGATAGGTCCGTCAAACACCGTCCACTT
GACGTCCGAGGACTCGTCCGCCACAGCTTCACGCATGATCGTAGAAGCCAAGCCGTCGTGCCACTCCTGAGTCGCTTCGTTGAACTCTCCGTACAATTCC
CCCATGGAGATACACTTGGGGTTGAGCACTCGAGCGTGGACCGTCTGGTAGACTGGATTCTTGGACCCTTTAGCACGCAGAGACGTCATAGTGGACTGCA
GTGTTCGGTAGCACGAGGTCTTCCCCGCCCCCGTTGGACCCACCAGTGTCCCTCCGAAGCGGACGTTGAAGATATCAAACAGTTGAATGACTTTGGTGAC
GTACGTGGACACTTTTTGTAATCCTGCTTGTGAAATTTCCTCTTCGAGAGAGGCTTGCAGCTCTCCGTAGTCGTTCGGAGGGATGTCGGTGCCTGGGAAC
AAGTCGAGCACGATAGCGTGGAAGAGCGGCAGATCGTCTGCTAGGAACTTGGGGATGTTGCTGTCTCGGAGAGCGCGAATAAGCGTGACGTCCTCGTTTA
AGTCAGGATTAGCACGTTTAAGGGACCCGGCCATCACCAGCACGGACTTGACAGCTCGAAGCCCGTAGTCGTAGTGAGGCTGCTGAGAGAGCTGCTCACT
GCAGAGGATATACAGCTTACACATCTTACGAGACAGCGTACGAGCGTCGCCGAACCCCTCCGCAAACAGCATAATTTCCGCGATAAGCGCGTAATCCGGT
ACCATCATGGATACGGGTCGGAAACACACCTTAAGGTTATCCGGAAGCTCGGTGCGACCAGCATAACCAGGATTCATCGTCACGATAACGTGGTGATCCT
TAAGTAAGATCTCGATGCCCATGAAGTTAATGTGCTCCTTACCCTGTATACGACCTTCACGCAGGATAAGCAGTTGCTGTGCCACCACGGATAACACTTC
GATGTCAATGCGGTTAAACTCGTCCAGACACGTCCAGTTCCCGGCCTGAGCGAGGCCTCGGAACAGCTTCCCCATCATTTTATAGTCGATCTGGTCACTG
CAGTTAAACACGACACACTGGATGGCCATCGCTTTGGCCAGGTCTTTACTACTCTCGGTTTTCCCGGTCCCTGCAGGTCCAGCAGGAGCAGCGCCCAGCT
TCATCCCGTACGCCCCCGTGAGCGTCATCCAGCAGCGATCCGTAAGCGGTGTGATCACTAAACGAGACGTAGCGCCCATATACTCGTACCCATACTGGAT
AACAGAATCCGAATGTCGGATAAGCACATCGTCCGCCTGGGCGTCCCAATAGTACCGAAGCTGCTGCTGCCAGATAAAATTCCCCACCGAGTCCACTTTC
TCGGTCCACAAACTCTCCACAATGTCGCGCGCATGCACGTCAGTCGTCACCAACGCCACGATCACTTTGCGCTCCAGAGAGCTGAGATCTCCGCGGATTT
TCACGATAAGCTCGTTCAGCTCGTACAGATTGCGTTTGTACCACGCGTGCATCTCCTGCACTGGATTTTCACTCTTAAGCGCTTCTTCAGTGCTTCTCGC
CCACGTCATCTGAGCCACCGTAGCCACAACTTGTCCAGGATGATCGCAGACCCACACCGAGCGCTGCTTTGAGTCGTAGTCGAGTAATCCAGCCTTCATT
AGCTTGTAGATGGACTGCTTCATACTCACTTCCAGTGCCTTGAGCCAGTCCTCGACGTTTCCTCGCGCTTTCAAGTTTTTACCGAGCGGAACTCGCTCGT
TCTCGGACGAATACATGGCGAGCATGTCCACACTACCGGGGATATCTCCAAAATCCAGTTTGACTAGATTCTCGAAGCATTTGCGCAGATGTGGCTGCAC
GGCTTGTGGATTTTTAGACTGCGCGAGGATTTCCAACAATTCGTCGTTGGATAAAAAGTAAAATCTAGGAAATGCCATCCGCTTCGTCTCGAGATAATCC
TCGAGGTTTTTCTGGATTTTATCCAAATGCGCATTGTGCTGCTGCAAGGTTTCTTTGATCCCAGGGAACGTTCCCGACGCCAACACGTGTGGATTCTCAT
TTGTACGACGCATAATTGTCTTCCACGACGCGTCCACGTGACTGAAAATCTTTGAGGCATCCGGTAACTGTCTCTGAATATCTGGAGCCGAGAAGATATT
CTCCAGATACATCCAGTTCTTCTGCACCAGCAGCCACTCGTCCAGTGTCTCCTGTAGAGTAACGAGCTTCTTCCTCCAGCCTTCCACTTCCTCCTGAATC
GCACCGATAAAGCGAGAGCCCATAATGGTACTGATCGTCACGATCGAGTCATCCAACTTCGCAGTGACCTCCTCCACACTGCCCAGCACGAACACATCCT
TGGATTCTTTGTACGGCTTGACCTCAAACTCGGTCGTAGCCCACGCATCCGTGACTTTCTTGAGCATTTCTTCGAGCACCGCTTCTTGTTGGGCAGATAC
AGCCACAGCGCTGATAGTCTCGCCATGTTTCATCACGTTTCGCTTGATTAGCCCACCCAACGTCATACTACTCTCTCCTTTCATCTGGAACCCCAAAGCA
GCGTGGATTTGATCCCAGTGTCGGTCTTTTAGCGACGACGAGCGTAAATCGGTCACCACGGGGAGGACGAGCTTGAATTTCTCCACTTCTCGCTGCAATA
AATCCGCAGCTTCGTTGCCTGGC