Description :
From Genome Similarity Track
Location :
Scaffold_550:8165- 9451
Sequence
1286 bases(100 bases per row)
GTGCCTGAACGCGCTCTACCTTCAACTCGCCCATTTTCTTCACCAACCGACCACGATCGGCATCGCGATCGGCGAAATCCAAGTTAGCCGATCGCGCTGA
GTCGTGAGATCTGAAATCTGAGCTGCGAAGCTATCGCGCTCAGTCTTGATTGTACCCAAGTTTCGCTGGGACATGGCTAACTCCCGCACGATTGCGGACT
GGCGGGCGGCAAATCGGGTTTTCGCGTTTTTGATCTGGAGTTTCGCCTGACCATCGGCATCCTTGGAAGACGCAATCGCTGATTCCAACTCGATTTGGAG
TATAGCCAGTTGACGCCGATGCTTCTCTTTTTCGGCATGGCGGGCCGCTTTAAGCTTCAGGAGGGAAGATTTCAGGATTGGAATTTCTTATAGACGTTCC
TTGATCAGCCAATTCCTCTTGGAATTCAGCGATTTTCTGTTCGGCATCAGCCAACGAGTCACGCATATTGTCGTACTGCTTATTCACAATTGCCGGATCG
GTCCTTCGAATTATTGAACGTCGCGCTGTTGGCGTTCCAAGCGATCGCCGCGAATTTCTTGAGCTCTCAACTGATCGTGGATTGCACTGTAATCGGTTAG
CTAATCTTGACGGGCCTCAGCGCAGTCGTAGAGATCGTCGATATACGTAAGGTACGCCGATCGATCACAGGGAGAAAGCTCACGCGGCCGCTCGGAAACG
AAGACGAAGAACGTAAAGAAACTGCGGCCGGTTGCGAGGAGCTTGAAGCTTCAGGCAGGCCCGGGCAGGTGATCGACTGATCACCAGAAGAACGTGGGGC
GCTGTGGCCGGCGGGGAAGAACCTGAAGCTTCCAGTGGACCTGGGCAGGTGATCAACTGATCACCAGAGTCGTCCATGAAGAACAACGCGTAAAGCAGAA
CTACGGAGATGGAGATTACCGATGACGAATTGCACAGACACACCAACACTGTATGTCGGTTAGTAGTGCATGAGACGGCTGTGGTAAAGCGGATCGAAGC
AATCAGGGGCGATCGTTGGGTGGAGTGATCTCAAACCACGACAGTTCATTGAGAAGGATCGATTGTCTGTTAATCTGCGCAATACCAAGACCGAATATCG
CAATATCAAGATCGAATACCACGATACCGAGAGTGAATATCGCAATACCGCGATCAAATATTACAGCAACGGGATCGAATATCAAGTTGCCAAGATCGAG
GCAAGATACCAAGATCGGGAACACATAAGGTGTTCAAAGTCGGGAAGATGACCGACAAATTGGCAGGGATCACGGTCCTAGAGAGT