Description :
From Genome Similarity Track
Location :
Scaffold_1239:816- 4511
Transcript NameFunction/comments
Physo_145446reverse transcriptase

Sequence
3695 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGTTAACCGCTTCAGCAAGATGGTACATCTTGCTGCAG
TACCCGCTGAAGTGACTGCGAAACAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCA
GCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAG
CGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCGGAGTTCGCCATCAACAACT
CGGTGCATGCCTCGACCGGGCATACACCGTTCTACATGAACGCCATCAGGCACCCACGCCTCCCGAGTCTCCTCGGGATGGTGGCTCCTTCCTTAAGTGG
GGGAGGATCTCCGACAGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCAACGACACGAAGTAAAGCCACGAACCGCGCGTCT
GTGCAGGACACAGACGCCGACAAGCGCACGAAGAACGTGTCTGTGCGGGGCACATACACTGACAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAACG
GGTCTGTGTAGGGCCCAGACACCACGAAGACGAACGCAGAGGCCGGGCCTACTGCTGGAAACGAGCTGAACGAGTTCGGCTCGGACGTAATCAACTTCGT
GCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATTGCAGCTTCGGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGCAGGGGTAACACA
AATGAATTCAAGAAGGATTCATTGGTTTTGCTAGCTACTCAAAACCTGCCTAAACATGCAGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCA
TCGGGCCGTTCACGGTGTTGGTACGGCATGGCAACGCCTACACGCTAGATATTCCATCTAGCATGCGCCTCCATCCGACCTTTTACGTCGGGCGGCTGAA
GCCATATCAGCAGCACGAGCCACCTAGCTCGGCTGGCCCGAAGCGGAAGCCCCAGCGGGAGCGAACCTCTGCTCCAGCGCGTGAACGCGCTGGGCCAAGC
GTGCGACGCGACCTCCCACGTCGACAGAGATGTCCGACGCGGTCTGCGAGGCCTGAGCAACTTGAGCTCTCAGGGTCGCCATCTCCTGCTTCAGAGCGGC
GAACTCCCGGCTCTGAAGCTGCTCCACAGCAGCGACCCGCTCCTCGAGCGTCGGGCCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACC
ACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAATACGCTGGATTGTGGAGCGTATTGTGAACCATAGTATCCCGAAAACGAACCGGCAGCCGGTTCGT
TATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAGATACATGGGAGCCACGGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGAGTACGAAG
CTCACCACGCACTGCCGACGCGAAGGTAGTGCGAGCGCTGTGGTCACCTACAGCGCCCGAGGTCCCACGATCGTCGCGTTCCTCACGTGCGAGGAACTTG
ACACGGAGATCCTTGAGACTCTCAGGTACACGAATCGTCGTGTACCCGTTTAGGTCGCGGTCGCTCAAGTGCACCGCACCCGGAAGACACAACGTGCACT
GTTGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGTGGAGCTGCTCCAACCTCCCGCGCGTCGAGAATGTCTCGAAGCGTTCACG
GGCATGCTTAACCCGCTCGCGGTAAGCAGCCGGTTTCTTGTTGAAATTCTCAACAAAAGCATACCAACTTTGACAAAGTGCCTGCCACTCAGGCA