Description :
From Genome Similarity Track
Location :
Scaffold_74:816- 12505
Transcript NameFunction/comments
Phymu_g3498acetolactate synthase small subunit, putative
Phymu_g3499family 3 putative glycosyl hydrolase
Phymu_g3500conserved hypothetical protein
Phymu_g3501conserved hypothetical protein
Phymu_g3502conserved hypothetical protein
Phymu_g3503cysteine protease family C01A, putative
Phymu_g3504hypothetical protein

Sequence
11689 bases(100 bases per row)
AACGGCAGCAATTTGACTTGATTACGAGTAAGAATGACTTCTCCCCTTAAACACGAGCTACGTCAGTGCGTACGTCGGATGCATTGACCAAGAAAACAAA
GTGCACCGGAAATCCTACCGACATCCTCTTGAGCGCTTATccaggaggaagacgagagATATCAATCTCTACATCGTCAGCCTCATCTAGAAGCGTGCGT
GTGGCGCCCTCGAAAGTGGAAAGGTCCCCCAGTTTGTCagtgacgctggtgctgcgaGCCATGGCGATGACTCCGCTGCGGTGGATCTCCGTAATGCCCA
GAGGCTTCAGCAGATCCAGGAAGGCCTCAATGCGGCCAGGTGTGCCAGCCAACTGGACCATCACTTGGTGCGGTCGTACGTCGATCACCTTGGCGTCGAA
CAGGTTGGCGAGCTCGACAACCTCGGCGCGAGATCCAGCCTCTGTACGTTACAGAACATCAGCAGGAGTTAGTGTAAGGTCCACGCACAGAATTTCAGTG
GTGAAACTGTAAGCAGGATCAGCAAATTGAACGTACCGGCCGTGGACACCTTGGCCAGCATCAGATCGCGCTCCACGTAGTTCTTCTCGGCAttcttgcc
gctgctgagGATGTTGACCACAgccacgtacacgacgtcctcaagctgcttcttcatctgcaagAGAGCACAACAGAACAATTAGCCACCTTCCAATCTC
CCTTCCCGTTGTAAACTACTGTCCGTACGTTGACGACACTCTCCGCCGTGCCGTTGACGACCACCGTCATGCGGGAGAGCTCCTCGACCTCCGTGCGGCC
CACCACGAGACTGTCAATGTTGTACCCTACAGCAAACATACACCCGAAAAGTTAGAAACCTTCCTTTATTTTTTTCTACAATCCTTGCCCACCTCGAGCG
GCGAAGAGGTTGGCGATCTCGGCCAGACAACCGGGTTGGTTGACCACCAGGGCGGCGATCACATGGCGCTGGCTTTGCTCAGCCAAGCTGAAGGCGCGCG
AAAAGTACTTGGGCGCGGCGCAGGACGGCACGAGCGTGGCCGTAGAGCGTGGGAAGGCGCGACGCGCCAATGGCAGCACAGACCTCCGCAGCATCTTGCC
GAATGTCGAATGTGGCGCCTGAAGCTCGTGGCCTGCAACCAAAAACAAATGCGCAAACACATCAGCGGTATTCTCGGCTAAGTACGCTCCAAAGAAAATG
ATCGTGGAGCCTACGATCAAGATTGTGATCGTACTTAGGTAGATGATGTATACCTTGTATACACTATCAAATCATTTAGCGACTTTTCAGAAAATGATCG
TGGCCAAGGAtctcgtgctggtgctggtgctgtgctGGGCATCGGAGCTCGCTCTTGCGACCACAGGAGCTCCTGATGCTCACGAACTCGTGTACGACCC
GCAGACCGCTGTTTTCGGCGATCTTCTGGGCTCTGTGGATCTCTTAGTCGCCTCGAGTGGCGTCGACATCGATGCTTTGATTGCCAATATGACGATCCGT
CAGAAAGCGGCACAAATGACGCAGATGGACATCTACTCCATGTTGAACGGGGACGAGAGGGACCCCAAGAAGGCTTTGAATCGGACGATAGCGGCTCAGT
ATGCTCGTGAGGGCGTGGGTTCTATTCTCAATAGTCCCTTCGCAGGGGGACCTGTTGGAGGCCGCACGGGCTGGAGCGTCAGTGACTATCGTGAAGTGAT
CGGGCAGATCCACGAGATCTACAAGGAGGAGGGTGCAGTGCCAATGCTTTATGGTATTGACACCACTCATGGCGCTAGCTACGTGAAGGGCGCCACTCTT
TTTACCCAGCCCATcagtgctgctgcctcaTTCAACCCCGAATTGGTGTACCGAATGGGCGCTGTAGCTGCTAAGGACACATTGAATGCGGGTGTCCCGT
GGGTCTTTAGTCCAGTGCTGGGTATTGCAGTGCAGCCGAAATGGTCTCGTGTTTTAGAGACATTTGGAGAGGACCCGCTGTTGGCTTCAGTCATGGGAGC
CGCACTGATCAAAGGACTGCAAAGCTCAGGCAAAGTGGCAGCTTGCATGAAGCATTTTATTGGCTACTCCAATGTCCGTGAAGGCCTTGACCGTGCTGAT
AACGTTATCACGGACTGGGAGCTTGTGAATTACTACGCCCCCTCGTTTCTCGCTGCAGTGCGTGCTGGCGTTCTTACTGCAATGGAGAGTTACGTATCGG
TGAATGGAGAGCCCGTGATCGCCAGCAAAAAGTTACTGGTTGATCTTTTGCGGCACGACATGAACTTCTCAGGGCTGCTGGTCTCGGATTGGGCCGAGGT
CGACCGCATGTACTATGAGCACCATTTAGTTCCCAGTGTGGCTGAGGCTGTCCGTGTCTCCTGGCAAGAAACTTCTCTCGATATGAATATGTCACCAAAC
TTGAAGGCGTTCGGTGACACGATCGAGTCGCTGGTCACCAAAGGGCTCCTTTCAGAAACTCGTCTCGATGAATCTGTGCGCCGCATTATGGAAACGAAAC
GGGATCTCGGCCTTCTGGAGTTGGGCTATTACGATGACTTTAAACGAGACGATGGGCTTAATTCTACTGTTGGCAGCCCCGAGGATCAAGAGGATGCGTT
GAAGTTAGCGCAGGAGTCTGTTATTTTGTTGGAGAACCAAAACAGCACTTTGCCTATAGACCTGAAGCAAACGAAGAGCTTGTTTGTCACTGGTCCTGTT
TCAGACAACAAGGGGTTCCTATGCGGTGGATGGTCTGTCTTCTGGCAAGGGTCGAGCGACTCCAACGCTTTTCCAAACGGTGTCACTTTTAAGGAAGCCG
TACAAGTGAAGGCAACCTCTTCAGGCGGGAAAGTGAAGGTTGATCATCTCGACGTGGTAGATATTCACGGCAAGGTGAACCCGCAAGACTTCCAACGAGG
GCTACAACTTGCGGCGAAGAGTGACTATACGTTTATTGTGTTGGGTGAACCAAATTATGCGGAGAAGACTGGCGACTTGCTTGGGAGTTTGGCTCTACCC
GCTGGACAGTTATGGTACCTGGAGGAGCTAACAAAGCTCAAATCTACCAAGGTGATTCTCGTTCTGGTCCCTGGCCGCCCCCGCTTGCTTGAAGGAGCCC
ACAATCACGCCGACGCTGTTCTCTTGAGCATGTTGCCTTGTGAGCAGGGTGGCCAAGCACTGGCGGATGTGATATTCGGGGACGTGAATCCATCAGCCCG
TCTACCCATTACGTATCCAGCCCGTGGCACGCAACTACTGCCGTACTTCCACAGAGTTAATACGCGATGCCATCCGTTTGACGAGTGTCCCGTGCAATGG
CAATTCGGCCATGGGCTCAGCTACACGAAATTCGAGTATTCGGCATTGCACCTCAACTCTACCCAAGTGCACGCTACGACTGGTGcattgaagctgtcgg
tcACTGTGACGAACCGCGGCAACCGTCCTGGGAAGGAGGTCGTGCTACTGTTTGTATCTCAGAAGTTCCGACGTGCGTCTGTGCCCGAAACCAAACTGCT
CAAGGCGTTTAAGAAGCTCGACGAGCTGAAGCCGGGAGCAAGCAAGAAGGTCGAGTTCGTACTCACGTCTGAACACTGGAGCTATTACAAGCCGCACGTG
GTTGGCCGTGGCTTCCAGCGGCAGACTGAGGCCGGCGAGTTTGTCATCTCTCTACTGCCATCTTCAACGGACAGTTCGACGATGACAACGCCACGTCCAC
AAGATGAAAGCGGCTATATGCACAGCCAGAATGCAAACCGTGGCGGTCCCAGCACAGACCGACTTGATACAGATACGGAGTCTGCCTCAGAACTGAGCGT
TTCATTCTTCGTGGTATCTGACTGATCAAGGGCCGTCAAGTGAAGCAATGAGTAGTTACAGCCCCGAAGCGGCAAAATAGCAATGGCTGAGCGATATGTC
GCAGCGTAGCAGACGTAACAGTGCATGTTGCTGTCAGAAACGACCTGAGTCTGTTCGTGCTTTTTGACCTCGATGCGTTTGCTGAAGAAAGCAGCGATCT
GGACGTGTAGGCGACTTCGATGCCACTTTTGCCGTCGTAGCAGTTCTTGTCGCGCCTCACGCCAACAAAGCGTTACGTCAACACTCACCTTAGCAAGTAA
TACTTACCATACCAAACAACTATAATTGTAGCGATGCGAACGCTGCAAAATTGTCATTCcgcagcaacttgagctCTTatgacaacttcaacttgcccAA
GCTTAGGATTGCCACTTAAAAGTCTATAGGTGAATGTGATGGATCAAGCGATAAGAATGGCAGCGGTCATAGATCACGGGTCGCACTGCCGCTTTGGTCA
GGATTTCTCCTCCCGGCTAATTAAACGCTGAGTCGTCATTCGTCGTCGGGTAGAGAAAGCTtccattttttttaataataaccagctcttcaagcgCTTA
ATCGCGGAGCGTCTCCCGTCCCACAACGTCTTGGGCTCCGCAAGCCGCTGACCATTTCAAGTAAGAGACtccgtccagcagcatcgccCAGACGCACACG
CTCTCTGACCCACGAGACACTCGCCATCCAGCCGCCTTGAGCTGCCAAGGTCGCTTACGACAGCGCGAAACCCAGAAAGAAACGCCAAGCAACGGGCGAG
GAAAGGCGACGCAAGCCCGCTGGAACACGCACAAAGCACTCTACTCCGCGGCACCAACGAATAAGCTCTGCAGAGCTTCTGCCGCTGATCTCTCAGTTGA
CAATTGACCGAGACCGGAGAAGCGAACGACACGTCCATGACACAGGAACTGTCTTCTCTGGTGGCGGAAGCCTCAGGTTACACGGAGGCTCAGCTCGTGG
TGCTTATTCTGAGCGTCGTGGTGGTAGCTGTAGCACTGTTGTCCTACTTCGTAGTCGCACCTGAGTACGAGAAGCATCTGGACAAGCAGTACGCTGCCAT
GGTGCACGCATCCTCGGAACGACACCTCCAGAATCAACGCTCGCACGAACTACTGCAGGCACGGATCAATCTGCGCAGTCACAAGTCGCTTGGGGCCTGG
GACATCGAATCCggctccagcgacgacgacggatTCAGCCGGAACACGGTGCAGAGGCGACATTCACAACTACGACCGCCTCCAGCAAGCGTCTCGTCGT
CTCGGGATATGATCATCGAAGCAGCCCAAATCGCCCGTAAGGAACGCAACGCCCGACGTCGTaagagcgagagcgacgCACTCAAGCAAGCCAATATCCA
ACGAGCAGAGATGCTGCGACGTCGAGTTGTTCTCCgcaagctggaggaagagatcGCTGGTACTGTTAAGGCCAATGAGGAGGCGCAAGCGGCCAGTTCG
AACCCAGCTTTAGCTAATATTCGACGGCTTTCAAACAGCACACTGGATCTAAGCAACGGCCGACTtaaggagctgcaggagcaccCGGCCGACTGTGTCG
AAGAACTCACGGTCCTTGCCCGAGCCCAGTCACCGACTGCGTCATCGCCTCTTGTGGAAAACGATTCCAAGGGGAAGATTGAGACTGTACCGGACCTTCA
CGAAGTGAAGCGAGCGCTGAGAGTCCTGCACGACGTGCTGAGCTTCTACTTGTCGGTGGATCATCGTGACATGACGAAACTCACGGTGTTCtgcaactcg
ctgcttcaACACGACGGTCTCAATCGACTGCGTGCGTTCGAGGCGTCGCGTGACCAAGATGTGCGAGTGCTGTCCAACTCCATCATCGAGAAGGCTGTGC
CTGCCATTTGGCACTAGTCCTCACACTTTCCTTTCTATCTATGAATCGCTGCTTCCAACAATTgtagagctccagcagtgcgCCCCTGAACCAGTAAATA
AGTAAATAGCTCCGTTGGAAGTTTGCACGCTTAACCATGAATCAGTACTGTCCCTGTAAGAtcaaaaacaaaaactcGTTGCATTCATTTGAAGACTCAT
ATTTTGCACCTACTTCTGCTGGAACGACGCTGCAATCTCCCGCAACGAGCTCGACAGCACCGTCCTAAGTACTAGGCGGGAGATAGAACCACCACATAGC
AGCACACTGCCGATCGTGGACGGCGTAAGCTTGGAGTTCCACAGGATGAGCGTCTTTGGCTGCGACGCGGGTGCCGTAGAGTCGGCCACGAACTGCACTA
GAGCTTCGTGGTCGCTCAACAACAGTGGGCCGCTCTTCTTGATGCTGTAGCGCACAGTAGGGATTCGATCCGAGTTGTCAGGCGGCCCCGCAGATGAGAT
CTGCTCTTCGACGCCGAGTGAGACGAGCCGGCGGTTGCCGACGAGTCCGCGGCCTTCGCCAGGCTTCAGCGTCGAGCCACGACCGACCCACTCCATGCGC
ATCCACGCGTCGTACGCATCGTCAACCGACGcgttcacgagctgcttcagtgcCAGCTCCTGTccgtcgttctcctcgtacGCCTCGAAGCCGACCGCAT
CAATGTACCTGTCCGCCATGATATCGAAGGAGAAATGGGGAAGAATGAGCAGGATTGGCTAAAACCAGAAGACAACGTGGTTGGCAGTTAATAAAAATTG
AAGAAGATTTATAGCGAATTAAATGGCAAATGCAGCGAAAGTATCTTTCCGACAGTTACGGTACTGAAGTCGAGTGGCGCCATGATTTCATCTCGTTCGA
AGCAGATTCGTCCAGCATGCACGCGCCTGTAAATTGTATTGTGCCTGCCAAAATGGCATTATGCAGCTTTATTCTAGATGCCGGTTCGCtctggcagcag
cacttgctgccaGCGTGCTGAGTAAGCCCTGTAGTGCCGAGCGCAAGATAAACTTGGTGAATCCGCCCCAGCACAATAGATATCCCAGCAGCGAAGGCTC
CATCTTGAGTGACCAGATCACAAGAGTCGCTGGCGTGCTCTCCGGCGACGCCGCTACGTCCACGAACTGCACGAACGCGAGGTGGTTTTGGATCGGGAAG
AGCCCGAACTTGTGCATCCTGTAGCAGATCGAGGGGATCTTGGATCGGTCTCTGTGGGCTGCAGCGAGACTCGGACGCCCTCCGTCGCTATCCACAGGCT
CGTCAATCGGCAATCCGGCTGATAAAATCTCCTCTTCGATGCCTAGTGCAGCGCTCCGTACATGGCCCACGTAGCCTCGTCCAACGccctcgtgcagctc
ttggGTTCCACTCAGCCATATTTCCTCCAACCACGCGTCAAATACTTCCGAGGGAGAACCGATGACGCACTCAGAaaccaccagctcctggccctggtgg
cgctggtaGTCTGTAAAGGCCTGCGCGTCCGCATACCGTGCCGGGTCCAATTGACTACGGCGCATTCTCTTTCAAAGCGCACTCTTCTTATCAAGAGAAA
AACTCATTTGGCAATCTCGATATTGGCCAATTAGAAATGGCCGTCTAACTAAATTGCAtggtgcttcttggccaacgTTCCCAGGAAGGTCTTCAACGCT
GTACGGAATATTAGGCGGACCAGACCGCCACAATGCAACCAATTGCACATACTGGACATCTCCGTCTTGACCGtccacagcaccagcgtcaTCGGCGTTT
TGCTCTTCTCGCGTGACGCCACCCCTGGGTCAGATGCGTCAATAAATTGTACCATCGCTAGGTGGCTTTGGAGGGGGAACGGGCCAGGCTTACGCACTCG
GTAGCAGATTGACGGGATCTTGAGACTCGCGTCTCGTTCTTCGCCTGGAAGTCCCGCCGATATGATCTCCTCTTCCACACCAAGTGGCACACGACGCACA
CTTCCAACGTAACCTcggccagcaccttcgtgCACTTGGTTCCCGCCAGTCAGCCAAATGTGGCGAATCCACGCATCGAAGACGCCCGAAGGAGATCCAG
CGACCAACTTGGAAACTTCAAACTCTTGACCTGCATGCACCTGGTACGCCTCCAACCCGATGGCATCCACGTAGCGATCGCTTGAAAACAACTGGGGCGC
GGTCATGCTTTGGAGGAGGCCGCAGCAAATATGATTGTGATTCCTACTGTCAGACTTTgcgctgcacgagctgaTTACAAGTTGCGGAGGTAGCTTGATT
TATTGTTATTTAACTTGGTACTTCAAGAACTTCCCCGCTTGGGAATGGTCGATCGTATAATTTACAGCGTCTCCTTGAAAGCATTGCGTTGGCGACTGGC
ATAGACAATGCCAACAACTGTGACGAAAAGCGTGACAACAGCTACTGCGATGCCAAGCACCACCCAGCTATCAGGTGACATCCCAACGAACTCAACAGCG
CCTCCACCATCAACCGATGTGTGGGCAGCACCAGCTATTGCGCCCGTCGGAATGATAGGGAAAACACTGAGCCCGCAATTGATCTTCGAGTCCATGGCGA
GCCGCATAAAACCTTTCTCCCCCCATGACGCGCCGTACGAGTTCTTAAGGATCCAGTAGTCTGTCGTGCCGTCCGAGCCATAGCCGACGAGCACGATCGC
GTGGTTAATgtcactgctggaggtgaaATCTCCGTCATTGGGGCAAGAGTAAATGCCGCTCTTGTACGAGTCAAAAGAACCGCCAGAGTTAATGGCAGCC
GAAactggctgttgctgcaatGCCAGTTTAAGCAGCTCGGATGAGTCGCTGCTCACGTCGCACGAAAGCCCCACAACTTGCTCCCAGCCTGAAATactgg
cagcagcattgTCCGTTGACGAGTTATCGCAAGCGTTGGCGAGGGTGGCAGCAGATGCCTGAGATGTCTCCTCTTCGTTGTACGGCAAGTCTAGTTCGCC
CAGAAGCGACCAGTGGAATTGTGCAGCATCGGCGAAGGCAGCATGGGTCATACCTCCGTTACAGGCGTTGTTCCTCGAGCCCCAAATCATCTTGGTTTGG
AGCCAAGAAGCCCCATTTACGCCGCCCTCCGCCCAGCAGTACTCAAATGTAGCCGCCATTTCCCTCGAGCTGCATTCTAAGAACTGCTGAGGCGACAATG
AATGCGGCGCAGTTCCTGCATTGATCACCACCGCGGACTCGAtggcatctgctgctgcaaaagaCCAGCAACTGCCGCACTGCTTCTGATTCTTGATGTC
TGTACAGATACTCTGGTTGTGCACATTGTCAGTTGAACACCAGTCCAACGTCGTGCGGTATCCTAGCGTCGAGTTTGCGAGTCGTCTCGGCTCCGTGAGT
CTGCGTTGCTGTTggcgttgtgctgcttggtgttcctgcagcacaaagTCCAAAGGTGGCAGCGTCCGACTGCCTTCTAGGTACAAATGCCGCGAGTTGA
CGCCCATGGCGAACGGAAATGACCAGTCCCGTCCGGCCGCGTGCTTGTGTACTTGTTCCAGGTAATCCACGTGATCCTCCATCCTGCGGCGAAACTCGCT
CGGGCCTACGTCCATCCCTTCGTCCTGTAGAAACTGCGTCACCATCGCATCGGAGGGCATGGCGACGCCGTCATGGCCCGCCCACAAGCATCTCGCTGCG
CCACAGCTCAACAAAGTACCAAACGTGGAGGGGTCGTGTGCCTGTATCATCGGAGCGGCCGTCGCTAAcagcgcgagcagcttggTACATGCCGGCGCCA
TCGTCCGTCCAAATTGACCCACTAGCAGTTATTAGCAGGTATGATAGCAGCAACGCTTGGGGGCTGCCCAGGTGAAGCCGGAAATGGCCGCTGGACTGCA
GATGCGAGTGTGATGATGGTTGCTGCCTTGGGCCAAATTCGTTCAATTGCAGTACGAGCATACAAAGTGCAAGATGTCGTGAGTCAGCCCAACCGACTGT
TTCAACTTGACCTTGCGGTGGGGCAATAACGATGTCGGCTGTGTGGTTTGCAGCCAGCAACCACCGGGTGCACTCAATCTGCATGTACAGTGGATACCTG
CGTATTGTTGGTGTTGGGATGTGGGGCACTTGGCGGAAGTATCCCACGCATGGGACGCAGTCGGCTGTACTAGTAGACAACGAAGGACAAGGGACATCGG
CCATGTTGCACGCGCTGACAGCACGCCGGTGTCTGGATTCTCAGCGCACAAACGCATGAAAGCGCTAGTAAACTGCCTGGTTATGACGTTGGAATAGGGT
GCAAAACTGTTCTGGCTCGCTTCAGTAGTTTTCTACCGTCGGGCGATATTTAATCAAACAATACACTTGACGTTGCGACGTCCTAATGCCCATTCTGGGC
ATTCATGGCTGCTTGGCCCCCGTACATGGCAGAGTTCTGCTTGCGGATCACCTTGATCTTCCGCTGCGAGACGCCGATACCGATTGCCGTCGTGACCAGC
GTGAAAATcgtcgttgcagcagcgacaccaATCCAACCCGTTGGGCTCAGTCCCACGAAGATCTTATCACCGCCGCTATCTACAGCCGTACTGGCCTGGG
CACCGGCCTTCGCACCGGTAGGAATGACTGGGAAAACGTTCAATCCGCAGTTGATCTTGGCGTCGGCaaccagcttcaagaagccACTGTCACCCCACGA
GCTCCCGTACGAGTTCTTGAGGATCCAGTAGTCACCGACCGACGAGTCAGTGCCATAgcccacgagcagcagagcgtggTTCAGATCGTTCTTGGACGCC
ATGACGCCGTTATTCGGACAGTTGTAAAAGCCACCAGCATACTCTCCAAAGCCGCCGTTCGAAGTGATAGCAACTGCAATgggctgcttctccagtgccg
aTCGGAGTAGCGTCGTGCAATTATTGGAAGCGGTACAGTCGCCGCCCACGATCTGCTCCCAACCAGTGATACTAGCGGCAGCTTTATCCGCACTGACGGT
ACAGACAGAGGAGGAGTTCGTAGACGACGAACTCCCAGAGCTCGAGTCGTCGTACGGCATCGTGAGCTCCGTGACTAGCCCCCAGCCATTCTGAGCCGCA
TCCATGAAGGCGCCGTGGGTCATGCCACCATTGCACCCGTCGTTTTGGGATTCCCACTTGATCTCCGACTGCATCCAACTAGCTCCGTCCACACCGCTAT
CTGTAGCCCAGCAGTACTCAAACGTCTGAGTAGTCtgcaacgagctgcaggtAAGGAACTGCTGAGGAGACAAGGACACCGCTGCCGTCGCGTTCGTTGC
GATCACCACGGCAGTCTCAATGGCGTCCGCAGCGACAAAAGACCAGCAACTTCCGCAGCTCTTTTGGCTTTTCACGGGAGAGCACACAGTGTGGCCCACG
GAGTTGTCTTTGTCGCACCAATTCCAGTATTCAGAGCTCCCTGAACTCGagatcgtgctgctgttggtacTGTTCGTTGTCTGTAGGCGGCGAGTGTGCG
CGGAAATCACTTCTTGGTCCACAAACTCGTCAGGTGACGCTTTACGGATAGACGACGAGGTTAAATGGCGCTCGTTCACACCCATGTGATACGAGAATTC
GTGTCCAACTTGTCTCGCGTACATGTTCACGTCTGCGTAGGAACCCACATTAGTGCATCGTTTCCAAACCTATAAAAAGAAGCGCTCGTCTGTCCTCACC
TTCGATGTAGGTCATGTGCTCCTGCAAGTTGCGTCCGTACGCCTCTCTATCGCTGTGGGCGACGTAGTGGCGctccaggaagagctcgcgCAAGGCGCGC
GAATCGACGACCTCGCCATTTTCTCCGGCCCATAGGCACGGTGAATCTGCCGATCGAACTGCAGGGCATCCCACAAGAGTACCCAGTGATCTGTCCGTAG
TCTGCACGGCGGCAACGCTACCCAGCGCCGCCAAAAGAGCAACGGTAATGGCTCGAAGCTGCATGACACGTGACCTCCTGGTGGCAAAT