Description :
From Genome Similarity Track
Location :
Scaffold_2050:816- 1826
Transcript NameFunction/comments
Phymu_g13846hypothetical protein

Sequence
1010 bases(100 bases per row)
GCCGGATCTATCGAGAAATCTTGGTACACTGGGTGGGTTATGAAGAGCCGACCTGGGTCGACGAGGCAGATCTCAATTGTGGAGCTATACTGAGTACGTT
CTTGCGAAATCACGTGAACCGTAACCGATTCGGCGTGATGCAGTCACATGAAGAGGTGTAGAAAGGAAGGCGGCGAGTCGAGGCGGTCGTCTCGCCGTGA
TCAACGTGGATGGTCTGGAGGACGATCCAGATCAGGAGCGGAAGTTTGCATTTTTGTGTGTGTATGTGAAATCAGGagtggtcgaagctgtcaGGTGGTG
TTTTCGAGTGGCTAAGTGGTGACAGAGCGAGATCACGGTacgatgacgatgaaaaAGATAAGAGAGGCATGGATCACGTATGGGACGTTTCGAATTAAGA
GAAGGGAGCAGTGGAAAGTTAAGTCGGGACTTGAGACGTGTGATGTCGAGGTAGATCCCTAACTACCCTCGAGGAGTTGACTCGGACATCGGATGGCGGA
CGGAGTTGGGGATCACGGTGCAGCAGGATGCGCAGGTGGGTTGAACTTGTTTGGAAGACGTGCGGTCCGCATGGAGGGATGATCGGCCGGATGATCACGG
TAGTGGTTCCGCCAGGGGTCTTCTCGGTCACATTCCGCGAGAGCGGTGATCAAGTCCGTAGGCTCCGGTCGATTCAAGTTGGGATCGGCCCGATTCGccg
atcgagaagctgatcCGGGGTACCAGTGGACCCGATCTCTCTGGGTGGGCAAATGCAGGAATATcggatcgagcagaaggTCGATGTCGGCCCACAAATT
CCGCATCAACGGGAGGAGagtgaccagcagcagtctccaaCGATGACCGATCCGGATTCGACGTTTGCGACGCGCCTTGTGGTACTGCTCGAGGACCGGA
TCGGCCCGGCACATGGCGTCACTGATCTCGATGTAGTGGGTTGATTCCCAGTATACCTGAAGGTGGATCGACACGAGACCGGAGAAGGATGTCGCGATCC
GCCACAGTGG