Description :
From Genome Similarity Track
Location :
scaffold_6:81592- 84579
Sequence
2987 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGTTTCGCGCCCAATCAAGCGTTGCTTACATAAATCATCTTACCCGGTCTACCACTTAACACTCTAGCTCTTACCCCATTTT
AATAGGTTGGATAATTAATCTCTTTAATCCTTCGACTTTATAATTATTTGACCTTCGACTTCTATATCTTAGTCATCTACAAAATATTCTGAAACTAATT
AATTTaaatattttgatattttttggAGGTTTTAAGCTATTGTCATTGATTATATTGGGATTGACTTATTATTTGAAAGAAATATTAATTATTTAGGTTT
GTTTTCATTATTAGGTTCACTTTCAGATTCGCTAAGTTTTGTTTTGGGCTTGCACGGATCTGCTGCCTATTCTTAcggtcgtagctcttttggtaTGACA
AGCAAGGTCGCTTGTGAGCTGatagtagcgcttttgtgcaACTTTGATTTTCTCTTTGTTAGCAAGGTATNNNNNNNNNNgacgatgtggttctcctcat
ccgttctaccgtgctctgcacgaccgTGAACAAAGATGTTGTCaaaatatgtctgtgcatacgccctgtggggcctgaacagctgcggcacaagacgatt
aaatgttgctggtgcatttgacagtccttggggcatcatcagccactcccagagcatgccgctcaaaGTGCCCACCGCTTTTAGTGGAATATcagtcgct
ctcatgagcaatgggTAATATCCNNNNNNNNNNTCCTTAATACAGAATTGACAAATTCGGATCTTTGAATCGATTCAATAGATTCATcttatttttttgt
ttgcaaTATAGCCATAGCATGCAAAACGGACCAAATAATCGCCATAAGTGCCTTGATATTGTTTGGGATTGTATCGCCCGATGCCATACTTCGTAGGTGC
CGCTTCCCCCATTGAATCAAAGAATTCTCCATCATGAACAGCCTGCCAGTGTCCTACATCGAGATTAGGCGATCTAAGTAGAACCAGATATGATCCTTTC
TTCGGAAGCGGCTTTGTGATCTCATTTGACTCAAAGATAGCATCGAGATGAACCCCAATACGCTTGGCAAGTTCAATTAGATCATGATCGGATGTAATAG
GCTTGACGAGTTCCATAATAATTATTTTTGAGAAAGTATATTACATGCCATATAAAATCTCAACGATGTCTGAAACACAACTTTCCGACCGATATCTTTA
CCAGAGCTCGCTCAAGAGTGATCCGGAGATTAAACTCTCCTCTGGTAAGCGCGTGCCTTTCGTTATCGATCTTAACCAGGGCTCATCCCAAAACGGTGTT
ATTACTATCGATGCTACATCCCAGCTTAATGGAAGTGAAGGATTCNNNNNNNNNNATATTTgccgaatataacttcgaggtgaagtataagccgggaaag
cagaatgctttgactgacgcgttgtcacgcagaccagactatgcttgctcatgttacagctgtaacgtcgtctgtgacagatttgatccgcaccgcgtat
gcgggtgatgagatgtgtagcgttgcttcgggctctagggagcaaggggtttgggaactcggacaagaaattgccacaaagactgcgtgcacgattgcac
cgatattcgttgaataacggcttgatatattatagcaccgatttaatggatacaccacgaattgtggcttcccatgatgaggattaaaaatatcgcatcc
tcaatGAGGCGCacaacacgccactcagtggtcatctcggtcgtgagaaaatgtacaactctttgagtcaccactattggtggcccaagatGTTCCaatg
aacgagcacctatgtgcgcgcgtgtgagacgtgtcaacgggtaaaaccctctccaaatgcggctgcgccgctggccagNNNNNNNNNNtgcgccgcatac
gcggatgATGATATATGTGtcgcgctgctacaggctctcgggaggaaggagtttggaaactcggataagaaattgtcggcgagTTTGCGTGCACGGTTAC
TCCgacattcgttgaataacgggttgctgcattatatagcaccgattcaacaggaaacaccacgaattgtggtttctcacaatAAGTATTTAAAATACTG
TATCCTAtttgaggcccacgacaacCCACCTAGTGGTCGTCTAAGTTGTGCGAAGACGTCCAGCTCTGTGAGtagccactactggtggcccaagctgtac
aaatgggcgAGCTCATTTGTGCGCACGcgcgagacgtgtcagagggtgaaccCTCTCCAAAAGCGGCGGcgtcgctggccagtttaccagtaccctccgg
gtgttggcagtccataatTATAGACTTTGTGTTAAGCCTGTCGAAGGACTcgacgggcaacacgggtgtggtggtctttgtggactgtttgagcaagatg
attcattttgcagcagtgccggacaccatcgacggtttgggtacagcgacgctgcttGTCGattgtgtctttcgacaacgtGGCCTCTCGGGATCAATTG
TCTGTGAACGAGACCTGCGCTTCAAAGTaaaattttggtctacaatcttcatggTGCTgaacaccaagttgactatgttaTAACCGAAATATCTGCAGAT
CGATGGTcaaaactgagcgcgtgaatcgcgtcactGGAGACGtctttcgcagcgtctgtgctgagacgccgaagcgctggagcgccatgctgccactcgt
agagctcgCTCTGAACACTGCAGTGCatgtgtctaccggctacacgccgttcgacgtgaacgggctttgtaatcctcgcgtccagctgacgccaccatcc
catggctcagggcttggtgggggaggaatagccgaacggctagctgatgtcagccccacaGCTCACATTGAAGccaatgacttcctg