Description :
From Genome Similarity Track
Location :
Scaffold_162:8159- 10807
Sequence
2648 bases(100 bases per row)
TAGACAGGATTGGTGGAGTTATTTGTTCGGACTTAAAAGAAACCATGACGCCGAAGGACAGGCATGGGAATAGATATATTGTTAACTTTATTGACCACAA
GTCGAACTACTGCCGCTTGTTTCTGGCACCAACGAAGGACCGGACTGCGAAGCAATTTGAACATTTTTTGTGTTTTTTAGAAACGTTTTAACTGCCGGAT
CCACGTGCTTCGAACGGATGGTGGCGGTGGGTACCAGAACGTTGACCTGTTCTGCAAGAGTAACGGTGTCACGCGGCAAGTCTCAGAGGCGAGAAACCAA
GCGTCGAATGGGAAGGCTGAAAGGGTACATCGGACCGCACTGAACATGGCGCAGTCCATGATCTTTGCAAGCCTCCTTCCTCTAACATTTGGGGCGATGC
CGTCGAATATGCAGCATTCATCTTGAATCTAGGTTCAACAAGCTCAAATTTGCGTCACGCGTCGCCATTGCAAGTGATCACGGGAGTCGCCCCCGATCTG
CGCAACATAGTGGTTTTCGGCTCAAGCTGCACAGTCTATCGCGATCCGCGTAAGAACTCGCTAGCTCAGCGAGCAGAAGTCGGCATTATCGTCGGGAGGA
GCGACAAAACGAAAGGTATCGAGTTTCTTTGCAAAAGGAAAGGGTCGTTATCGTTACGCAACATGTGAAAAATATTGCGACGCTTAGCGACGAGCAAAAC
AGCCATCTCCAGAGCGCGCTTGAAGAAGGTGATCCAGCAGCGCCAGATGCAGATGCCAGAAAGGAGTCTGAAGTGGCGTCGAAGAATTTAAGCGCGAGCT
CGGACAACATGACGCAGAGGGACGTCAACTTTGCGTAGCGAACGACAAAATATGAAGTCATGGACCCGCTCGTCACATGGTACGTGTGACGCGTCGAAGC
TTGCGCAGCAAGTCGTGGCACAGGAGGAGGCGGACAAGAACACCAGAATCGTTAACCACGTGTACAAGCGTGATCCGAAGAACTACGGAGAAGCAATGAG
AAGCCCGAAAATGGAGGAGTGGAAGTTCGCAATGCGCGAAGAATTGGCTGCGTTGGAGAAGAATGACGTAGACGTTAGGGGGAGCAATGTATTACACACA
AAGTGGGTGTATAAGACAAAGGCTACTGCTGACGGAGACGTCGAACGCCTAAAAGCGAGGCTTGTGGCATGCGATGATGAACAAGCTTTCGGGAATGATT
ATGTTTGCTGCCGTGATGGATATGTCGACGGTAAAAATCATTTTGGCTTTAGCGGCAACATGGGAAGTTGGAGCGAAGCATGGTGACATCCCTAACGCCT
ACGTTAAGGCTGATAAAGAGGCCGACCTGTAAGTTATCCTACAAAGTCCCAAACGAAATGGATGTGAGCAGTAAAACTGTCAAGTAGTTGGAAGCAGCGA
GTGTGGATGGGATTGCGCTGCAACTTCGCAAAAGCTTGTATGGCCTCAAGCAGGCAGGGCGGCTGTGAAGCCAGTTGCTTCATGATCGCCTTCTTGATGT
TGGTTTCCGACAGTGAGTTTCCGATATGTGCCTTATTGGAAGAAGGACGGAAAAGACCTTGTAATTGTCGGGGTCTACGTGGATGATCTTCTCGTAACTG
GTACGGACACGGCTGACGTCGATCGTTTCTTCGCGGGTCTTGGCAGCTTGGCAATCAATGACTTAGGAGCTGTACACAAGTTTTTGGGAATGCAGGTGAT
TATGGAAGACGATGGAAGCTACTTAATTGACCAAGAAACTGCTATTAGAGACATCCTGAGAGAGCATGTTTGGAAGATGCAAACTGGATGCGTACTCCTA
TTGGTGCGGATTGCTACGAGGTCCCAACAACAGCCAGCGCGCTGCTAAAGGATGAAGACGGTGGAGCTCCGAGCATTCGTAATTTTCAGTCGCTCTTAGG
AAGTCTGTTGTGGGTGTCGCGCTGTACGCGCCCAGAAATTGCGTTTGTTGTTTACAAGGCGACGCGCCAAACGCACCAACCGCGAGTTCACGATTACAAA
CTCGCCAAGCAAATTGCACGATACCTGAAGGTTACTTGCGAATTCAAGCTACGCATGACACCGGCGAAGAGTGTGCAAGATAAAGTGACGTTAGATTCTT
ATTCGGATGCGGAATTCGCGTCCGACAAGATGGACCGGAAGCCGCTGACCGGTGGGGTTATTTTGCTAAATGGAATGGCAGTGAGCTAGACGGCCAAGAA
ACAGGGCGGCGTATCACTCTCCACCATGAAAGCTGAATCTGTTGTAGCGTCAGAGCAGATGCGTGAGTTGCTAGGGATCCGCGAGCTGTTGGCAGAAATT
GGGGTGGCGCCCAAGCTGCAATGATTTTTCACGTCGACAATCAAGCCTCCATAAAGCAGCTTGATGGCGAGACTTCGTTGCTATAAGCGAAGCATATTGA
CGTGCGTCTCAAGTTTGTTCTTGATTTCTCACAACGTGAGATCTCGGCGCAGTATGTGAGATCTGAAGCACAGATTGTCGACCTAATGACGAAGGCTTTG
GATGCGGTCAAGCTTTCGTCGATGTGCAAGTTGATGAGCCTTGGGTAGAGGCAGGACTCAAGAAAGACAGAAGGAATTACGGTGGTGCCGCAGCCGAGAA
GGTATTTGCGCTGGACGAGAAAAGAGGCAAGAGGCGGCTGACGACACT