Description :
From Genome Similarity Track
Location :
Scaffold_215:8159- 9858
Sequence
1699 bases(100 bases per row)
GCCCAAGAGGAGGTAGAGAAGTGGGCGACACTCAAGAAATTTCTTAGAGGAGAGTTCAGCAAGCTCACCTATGGACAAGTCAGCGACGCAGGTAAAATCG
CAGACTGTTTCGTACTGAGCGAGAACGGGTACGCTACTACCTGGGACGACGTCGGGGGTTTAGAAAGTCAACTGAGGAAGATATAAAGCTGCGACTAGTG
GTACCTACTACATTGATTGACGAGATAGTGCTGAATTGTCATGATTCGGTGGTAGGCGGACATCAAGGGATCGTGCGAACCTGCTATCGCGTAAAAACCG
ACTACTACTGGACGGAGCTTTACGCCGATGTGGAGAAACACGTACAGAGTTGCGAAGACTGCAGCACCAGCAAAAGTAAACCCCACTTAAAGGGATAATC
TCCAGGCAACGTGGTGTCCGACCGGCCATTCCATGTGGTATCAATGGAATTTATCATTCCATTGCCTATGACCCGACGCGGAAACACGGCGTTGTTGCTG
TTTCAAGATCACTTCACAGGGATCGTAATAGCCGAAGCTATGAGTGCCACAGGGGCACTAGAGGTAGCCAAGGCATTCGAAGTAAACATTATTCGTCCCT
TCGGAGCGCCTAGCCTCACTCGTCATGATAGAGATCTGAGGTTCATAGGCGAAGTTTTTCAAACTTTCGCCGAGACGATGAGATCTAAATCAAGGGCTAC
ACTGAGCTACCGACCACAAGCAAATGGTCAACAGGAACGTAGCGTGAAGACAATGATACAGACCGTGAGTGTGTATGTCGAAGATCCGCTTCAAGAAGAC
TGGGATCATATCGCCGAGAAGATGGTCCGTGCCATCAACAACTCCAGAGACTCGACGATAAAGGAGACCCCGTTCAATCTGGTACATGGCTGGGATGCTC
ACTCCACACTGAAGGCTATGACTGAGTCTATTCGACGGCCTCCTGTAAAACCAGGCAAAGAAATTAACTCAGCGAACCCAGTCATGTGGCGCCGCGAGTC
AAACACACAACGGGAGATTGCCCTTAAACTCGCGAAGACCTACCAAGCGGACGAAAAAGCTCGACGAGCGAAAGAGCACAACGAACTACTCATCCCCGCC
GAACGACGAAAGATTTCAAGAACGTACCGACCCGAAACTACTACGAAAGCAGATCGACAGGACGAAGAAGTAGATACACCGAACGAGACTCGGTTCGGGG
AAGGAGATTAAGTTTGGTTGTTTATGGAGAAGGTGAAGCCAGATTAAAGAAGAAGTTATCTCACCGATGGCATAGCTTTTTCGGATCAAGAGACGATTGG
AAGACTTCGCTTACGAGCTAGAGCTGCGAGACCGGAGTGGATACAGGTTCCTTTCAGTCGTTCACATATCACGCCTGAAGTGAGTCAACGACACGAGCTA
GCGACAACGAGGCTAGTTGCAGGATTGTACGATACCAGTCGCTTCGACTTCGATGAGGAACTCTTGCCAGAGGACAGTTGGGTCTCAAATGAAGAGAGCG
GGTGATTTGAAGTCGAAGCGATTTTGGATGACGATTTACCACTCTCGACGAGTACTGAAAGGACACAAGGGCAGTTCCTGGTGAAGTGGAAGGAATACAA
AGCAACAACGTGGGAGCCGTTGTCGGATCTATCGTGTGGAGGGTTGTTGTTTGATTACCTACACCAGAAGAAACGCGATAACCGGTTGAAGATGGTGCA