Description :
From Genome Similarity Track
Location :
Scaffold_11:81562- 83313
Sequence
1751 bases(100 bases per row)
CACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCGCACACAACGTGGAACGGGCGATCTTGGTCGGCCAC
CGCCAAGATCGGCGCCTCCGTCAAGCCCTGTTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGT
GACAGCGGGCGTATCATACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCACAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTG
ACCTTCTCAGGGTCAGGGCGGACACCGTTTTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCAAGCAGCTTTCGGAGGTGCAC
CTTGTGCTTCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAG
TGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACTGCCGTGA
GAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATC
TTTTCGAGGTATCGGTGTCTGCACCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAGCCGCCCTATGGCTTCTTGATACAGAAC
GTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTG
GCCACTGCCGCGTGACACAGTACTTCGTCCCCGGCACGAGATCAATCTCGTGCTGAATGCCCTTATCCTGCGGATGCTCCGCAGGGATCTATTCCGGAAG
CACGTCCGTGTACTCCCGTAAGATCTCGTAGTAGGGACACGTTGAAAACGAGTCCCAGCTCTGCTCGTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGA
GTGTCCTCGCTCTCAGTGGTGCTGTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCAAATTTGCTCGA
TGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTC
CCTGTACCGGAATCCGGCACGGGTACGCGTCAACGTCTCGACGCCTGGCTTCTCAACCTTCGTCTGCCTGGCAGACATTTCTTGTAGCGTCTCGGCCCCG
GGCCGAGACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTTGTTTTGCGGAACCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACG
GGTGTTCTTATGTAGTACCGCCGGCAAATACAGTCCGCGGGCAAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACG
ACAGCATGCGAGTTTTTCCGGTGCGGGACGTTTGCAACCGTTCGCACCGCCTGCAGTGTCGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTG
TTATTGGCGGAGCCCTCCATTATGGAGGGTGCGTCGGCTCCCCGAGCCGAC