Description :
From Genome Similarity Track
Location :
Scaffold_699:8154- 12617
Sequence
4463 bases(100 bases per row)
GATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAAAGAGGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTATCCTCCCCAGGTCCCCTCGG
GGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCAAAC
ACCGTACTCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGA
AGACCAAGCTGGATCCAAGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATG
CAGATCCTGAATCCACGACAGATCGACGATCCAAGGGAACCGGTAAGAGCATCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTT
TGCTTACGGAGTCAGGCATCGTAGCTGGTGCGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGC
CAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGACCCAGTGTCGTCGCCGAGGATCAGCCAAGCTGCGTCCTCAAACTACGAATCCGCCGCT
GAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAG
CCCCTGTGAACGTGAAAGCTCGGGATCCAGTACGCCCTACGCGTGATCTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATT
ATCGTCAGATCAGGCTCGAGGTAATCGCCTCACGGATCCAGTCCCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACTCTGCAG
CGGCACTTTGAAGCTGCGATGAATCGCTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGGGACG
TGGAGATGGAGTCAGTAGAGGGGGACAACTCCCATGATGAGTTCGACCCAGACGATCTGGATGGCCCATCCACTTCGGCAGCCGTGGTAGCAACGGCCAC
AGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCTATATCGGACTTGAAGGAGTTCACGGGCAAGGATCAAGATGAGAACCGAGCG
AGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCA
GGAACTGGTATCGGCAGCTGGGCAGATCAACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTAGGAGTGTCGGTGGC
ACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTACATCGACTAAATGCGGCCGGTCTACGGGCTAAGTTGAAGATCAAG
GATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGGTGGGAGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCG
ATGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCC
GACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACCGAATGAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTAC
CGTCGGGTCTGTCTCACTGCATCCAACGATCGAACGGCAAAGACAGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGAT
CCCGAGGTCTCATGGACGGGGCAGCACAAGTCAGGTGTTCACAGTGAGGATCCCGGAAGCACACCGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAA
GTGTGGCAAAAAAGGTCATCCCGGGGATCACTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGTTGGAATAATTCTAC
AACCAGATACGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCC
GGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGT
GATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTGCCAGATCCGAAGTTTCTTCAACCCTGGATCTACAAAGGGGAG
AGGCACGTGGTTATTGGGAGAAGCGCCAACATGGCCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGG
ATCCCGTGGATCTGCTAACCGGGGAGTCCTGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAA
TGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTCAGGTTGGGTGCCAAGTGGATGGGAGTCGGATC
CATGACTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAAATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATCT
GGGTTGGAGATCTCGCGGGTCAAGACGCCATCCGCGGGATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATCTAGCGGATGGGACACTTTGTTTCCC
TGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTATGGAGCAAAGATGAGAATCATAAGGGCGGATAAGACAGCCTGGATCGAGCCCGGGGAA
ACCTGGGAGCTTCCAGACCGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTACCTACCGTAATCCAGGGGCCAGGTC
GATCACAATACCTCCAGGTCACGAACGTCAGCGATAAGAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTAGCGAAGGACGGTATCCCTAG
GCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCGCTCGGAGAAGTAAAG
CTCTCGGCGGAGCCAACTGGCTTCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGG
AGGTTGGATCCAGGACGGGGAACGATCCCCAAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAACAACCGG
ATTCCGCTGATCCACGAGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCACTAGTCAAACCAGAACCGTCGGGCTTAAA
CTCGTTAGAGGACCGACTAGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGATTCCCCGAAGACAGAAGGACTGCCAGGCGAAAGAGGGCCGCAG
TGTTCGGATCCAATGATGGATCCTACGAAGACGGAAGATGAGCAAGTTTGTTACCATGAAGGCGGGGATCTACACGCCGAGGACCTGGGAGAAGGCATGG
CGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCG
TCAGAAAATTTGGATGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCG
AAACCGATCGCTCAGAGGGTGAGGAAGGTGGCGTCTCAGTTCCGAGAAAAATTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCT
CAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATAGATTACCGGCTGGTTAACGGTCTGACTCG
ATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTA
GTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTCTGGACTGTTCGAG