Description :
From Genome Similarity Track
Location :
Scaffold_1327:8154- 10532
Sequence
2378 bases(100 bases per row)
CCAGGGCGGTTCTTCGATTCTGCCTTGCAGGATAAACTCAACTCATCACTAAGATAGAAACTTTCACTCAGACTACTTGGGCACCGTCAGAGAACTGTGT
ATACGGCAGGTGACCCCCCGTCTGGGAGGGTATTAAGAGCTTCCTGTCGATCTGCGAAACAGTTAGGAGATTAGAGAAGTCTAAAACGGTTAGCACATGA
GCGACAACAAAATGCTGTGAGTGAAAGGAAGTAAATTCCAAAGTGATCACCGAGGGCGATCGATGTATTGGTTTTCTGTGACTGTGAACTCCGGAGGAAA
GCCTAGGGCAACAAAACTTCTTTGATCCGCCATCACACGACATCTCAGTCGGAAGCATTACCCACACAGATGAAGTCCAATCAAAACATACTTGACACAG
GCCTCATCGCACGATGTACCGACACAGTGCAAGTGACACCAGTCTCAGCTCTTCCAGGAGCACCTTCCGGGCTGTGTCGCGAATCGTCCTGGAATGAGCC
GGCCGCAAGCTATATGGAGGTAGTTCAGTATAGGAACGTTGCTTAACACCAAATTGAATACAAAAATCCAACGTGTTAGTTTCCAGGTTAATTCACGACC
GATTACCAACCTTGGCGGCGAGAACTACCCCACCGCCGTCCTTATCCGCTCCAAAAGCTTTCGACCGTCGGACACAGCACACCAGCGTCGCACCTCCCCT
CCGTATTCTCCTCAGGGCATTTAGACACCTCTTCCTGCTTTGACACCGTCCGgagtgcccccccccctcgccTACCGCCATGCCGTCCGTCCCACTGCCG
TTCACGATCCCTGCGTCGCCAGAGTCGAGAGTGGCCCTTCAACTCAGTCAGACGACATTGGTTCTTGGTTCACCACGGCCCGCCCCGGGTCTCTCCTATA
GTTAGTGACAGTAAACATCCTGATTCGGGTTGGCCCGGCCCGCCTGCGACCAGGCGACTTGCTCATCCTCCAGCAACTGATCTTCAAGGATCTGGTCGCA
GGTTGAGTTCGAGTGAGGACGGGCGACACGTGTCCGAGACGGTTACCAGCGTTCCCACTCGAAACAGCTGCAGCCGAGAGTGATTCTCCCACTCCCACTT
CACGCCTCACTGGAATGGAACTTTATCAACAGGTACCACACATCTGCCAAACAGTTGCATTCGCGTGGCTTTCAGTAGCGGGTTTCCATTGAATCGATGG
AGCACTCACCGCCGGAGCTCTCACAGTCAGCTCGAGCACGGGCTCCAGCATGGCGCAGCTGAATTTGGCTAGGATCCATGGACGAGAGCGCTTTGCCCTT
CATGCAACAGCTAAAGCCTTTCATTTATATCCCGAAAGACTACGCATTCAACCGCAACAAGAACGTGGAGCAGAGACATAAATACGGGAATCTGCGGAAG
TGGGGTTGTAACGCGGCTGAGTGCGACTGACATAGCCCCGCCTGCACAGATTCCGGTATTTCTCTTTTTGCTCCACGCCTGAGCAGCGACAGACACAGCA
CTACTAACTTCTAGCAGCGCTATCACACTCTGCCGTCTCAACTCGTTTGAGGATAACCTGGTTCATGCTGGTTACGTTGTCGATCATTTCGAGTCATTAT
TTGACAAGATGAGTATTGAGATTCCCCTCAAGAGTTAGCTAGTACGCTACGATTGACCCCCTCTCCCTGTTTACAGGCAGAGTTGCTCCACTCGCCTGCC
TCGCGATGCTCGTGAAGCACGAGTTGTGATCGTGCTATACTGTATCGCCGAATTACCAGCAGGGTAGAAATTCCCAGAACATCTTCATCTACGGTTCTTG
AAGGAGTTGCGAGTCCCGCGCGACTAACTGGCCTACTTGAACACTTTGCTATAGAGGCaaacacgaagaagaggaagacatACACGAGTAGTCACGATGG
ACTTATAACCCTTTAGAATCTATACAAACATTTATACTTTTCAATGCAAATTTATCTCTAACGTTGCATTAGCTTCAGAACTTAAAACATATCACGAGTT
TATTATTGAGGCatattgctgttgctatACCATCAAGTGAGTTGAGTGTTCATGCGAATGCAACTGTTTGACAGATTTGTGGTACTTGCTGATAATGTGT
TGATGGATTTGTGGTACCTGTTAATAAAGTTCCCATTGCAATATTCATACGCCACTCAAAATGCAATCCATGCTCATCCGAAAAGAAAACAATTTCACCA
CTCTTTAAAAGCGTAACCTGTCTGTCTGTCCGTGGTCCGCGCACGATGCTACAaaaatttgattggctaataagTTAACTCGCATAAATACGATTTTCTG
ACCCGTTGAATGCAGTACCATCGGAGCAGCTAAAAGTACAATTTACCGACTTGACGGTCAGCCcttctctcattggcc