Description :
From Genome Similarity Track
Location :
contig_120:81537- 84276
Transcript NameFunction/comments
g11382.t1hypothetical protein

Sequence
2739 bases(100 bases per row)
TTCTTCCCCGTTCAACCTGCTCCCACTCATAGGTCATGAGCCCTGGCCAAGCCTCAAGCGACGAATTTCCACGCCTTATCGGAGCAGAGAACTTCGACGT
CTGGAAGGCCCGCGTATCCGCAGCCCTCGATGGGAAACATCTTCTCGGTTTTGTCACCAAGGAGGACTACGACGGTGTCTCTGACGACGAGAGCGAGGAC
AGCAGCGTGAGCGACATGTCCGACGTCGACGACACGCCCAGTCCAAGCCTGCTGACGAGATCGACTCGGATGCCGTCGACTACGAGGAGTGCGATGACGA
GCTCAAGCCTCCGTCTGACTCCGGCTCCGACGATTCCGGCGAAGGCATCAACACGACGATGAAGTGGAGCGATCTGCCCGAAATCCGTCCTTTCAGCCGC
CGTGACGCGAAGCGCGGGAGGCGAAGAAGAAGAAACGCGTGCTCAGTTCACGTGAGCGACGCAGGCTGGAAGCGAAGACGAAGGCGTTCCTGATGAAGAC
CATAGACAACACGCACGTCCGCCTCGTCAAGAATATCACCACGTCTTACGCCATCTTTCAAGCCATTGCAAGAAGTATGAGGGTGCTGCCTTCCATGGAG
ACCCTTACTTCATCCAGCACTTCCTCATGGAGATCAAGTACGAGGAGTCAAGCGACTTGACGGAGTTCTTCCTGCAGCTGGAGAACGCGATGAAAGCCGC
GTCCGAAGCCACCGAATCGGTCATGACTGATGGACAGAAGTCTCTATACCTGTTCCACTCGATGCCCAAGACGTGGAAGGATGATCTCCGCGTTTGGAAG
GGTCAACGAAGTATATTCCGTATGAAGAGCTCAAGCTGAGCATTGAGGCCAAGGTCCGCGAGATTCAAGCCCAAGAGCGCTACACGCTGGCAAAAGGCAC
ACCTGAGACGTGTACTACCAAGAGTGAGCAAGCCCTGGTTGCCGTGCCCGACCACACTGCGTTGAGTGCCCAAACACAGACGACTGATCGCATCTGTTCC
TACTGTGACCGTCCACGCCACAACATACGCCAGTGCCGCGCCTTGCAGAAGGACCTTCGCGATGGCCGAGTAAAAGCGGGAACAGTGCTGCCCGAGAACT
TTGGCTTCAAGGGTGGTAACCCGAAGCGTGAACCCCTACACCGTACAATAACAACACTCGGGTCGTGGACGTGGGCGCAACTACCAAAACCGTGGGCGCC
AAGATCGGAGCGACAACCTGCAGGACCGTAATAACCGGCAGGTCCGCAACACCCGGCAGGATAGCGACAAGTCCGAGAACCGCAACCGGTCTTTCCACCA
AGAGCGCCGTGAAGTGGGCCTGATTGCTGTTGCCGCCACGGTCACTCCCTCAATCAGCCTGACCGCACAAGCCACCGTGAGCCCTGAGCCTACGTGGACT
ATCGACTCTGGATGTACGCGTCATGTGACGCATGAAGCCCAGTGGTTTACAACCATGAATGCGAGCAGCGGCGCGATCACCGTCGGTGGGAAGCACGAGA
TCCCTATCGAAGGAACTGGCCAAGTGGAGATGGAGATCATTGACTCCAAGGGTTTGAAGAAGACTCTCACTCTACGCGATGTCCTCTACGCTCCACGACT
GCAGTTTAGCTTACTGTCAGTCCCAGCAGCTGTGAAGCATGACTTCCGCTTCAGCTTTGACCGCAAGCACTGCGCCATTCAGACTGATGAACGCTTCAAG
ATCAAGGCTATGATGGCAAACCATGCTGATCTCTACCAGTTCCAGGCCAAGCCTGTGTGAAGAACACGGCTCTCATTGCCGCCTCAGGTAAGCAACGCTC
TATGCTGCTTCTACACAAAAGACTCGGTCATCCTAACGTTCGCATTCTGCATGATTTACCTAGGAGCCAAGCCATAAGTGGCCTCGAAGACGAAGCCGTG
GATTCACGCACCCAGTTCTTCTGTACTGCATGCACGTTAGCGAAGTCACACCGCTCACCGTTTTACTCTAATAGAACTGTTGAACGTGCTCGATCTCCTT
TGGACAAAGTGCATACAGATATTTGTGGTCCTCTTCCTGTCCCAGTTTAACTGGATGCCGTTACTTTCTCATCTTTATTGATGACTTCTCTCGCTACATG
TTCACCTATGCAATCAAGAATCGTAGTGAAGTGTACGAATGCTACGAGAACTTCAGGAAGAGGGCTCTGAACATCTTTCGGAGCGATGTCAATGTCCTTG
AGTACCCGAATCCTATTGAAGACTGTGACATTCAGGTTTTGCAAGCCGACAATGCCAAAGAGTATGAGAAACTTGGGTGCACAATTTTCAAAAAGTACGG
AACCCACGCTCAGTTTACGAACGCATACACCCCTCAGCAAAACGGTGTCGCTGAGCGGCGCATGAGAACAATCATGGAGCGTGTTCGTGCCCTTCTACTT
GACGGCAATCTACCAAAGCCTTTGTGGGCCGAGTGCGTTCGCCATGTGACTACTCTGATCAACATGACACCTAGCTCAAAGACGAATGGCAAAACTCCGT
ACGAGTTGTGGTACAACCGCAAACCATCCATGGAGTTCCTTAAGGTATTTGGATGCAGCGCGTACGTGCATATCACAGAACAATATCGTGACAAGCTGGA
CGCACGAGCACGTTTGTGCATGTACCTTGGTCTTCCAGACCACAAGAAAGGCTACCGTCTTATGGACGTCAATACCCATGCCATTGTATATAGCCGTGAT
GTGGTTTTCAAAGGACGAATTCCCTCGCTTAGCAACACT