Description :
From Genome Similarity Track
Location :
Scaffold_223:81527- 83778
Transcript NameFunction/comments
Phyci_18216Hypothetical protein
Phyci_18217Hypothetical protein

Sequence
2251 bases(100 bases per row)
ACACTAGCTgctccgtgttgctcttgccggacacgggtagtgtcgggatgtggtccatggtgatgacttggaagggatacgtcgtgacgatgttgcctgg
tgactcgccttggattgtagggcggtccttcgccgtctcgtagccggtgcattccctgacgtagcgctggacactccggaaaaccccaggccaatggacg
tggcgttgtacacgttgatatgtgcggtggtgtttgccttacaggctagtgatggaggacgtcatcgcggagcgtctcgggaacgactagattcgcaagt
gtgtcacggtcttcggCAGCCTCGTTGCCTTTCACAGAATATTAGAGGAGGCCGCATTGACCTTCCGCATGCTGGTGAGCGACCTTGTGACAGTCCTTCA
CTACGAACCTGTAGAGGCCCTCAATATCACTACTCAAGTATTTCTTCAAGTTCGCGATCCAGCCTTGTTCATCCTGTGCTACCCGAATGCGGTCTAGAGG
AAGCCGATGAACCACAAGCTTTTGCAGAACTTCCGGTGTTCTATCACTGTCCCGCTTGCCCGCTCTATAGCGGAGCGTGTCGTTACTGTGATGCCTGGTG
CTGCCCAACGGCCCGAGTTGGTGTCGTCTGGCTTTATTGCGTCGTGCTCCGGCGTGTCCGTGACGCGGTTACCAGTGTCGAGGTCTTCGTTGACGGGGTC
GCCGAGAGCCTCTGCATCTGAGGCTAGTATTTGGGGCAGGGTGAGCTCTCTCAAACGGttcagtgtcttcaagtcctggatctcgtctgggttgtgagtg
ttccagccgccttgctgttgtaaatcttgaccaggcaacatgtcggcgctcgcattccaatcctgacgtacgtggagaagttcatgacggaccacgtttg
taacgtgttccgagatcgttaggagcttcaaccccagtgacttgcactccatcttatcctgcgtatatcggatgccaaaattggagtacccaaatactac
cagtcgcgcgaccccatccaattcttctacgagacagcacccgaggagcaatctccgatactcggccacatggacagtgaggtccgtctcgtagccggat
gcggcttgaacgacctcccaaccaggcagcttccagacaaccgcgctgaacgcaccgccctcccgcttagccttagctgagacgtcggtgctcatgtcgt
gaacctgtcattacaaccggaactgggatgacagttaccttcgtcacgcgtttccgcggggcgtttccctccagagcggtatcaacgaacgctcggggta
tgctgtttacggccaaagtacccaaggatctcctcttctcccttcatggaagggcaattccgggcctccaccgggaaaggaacgcggtcgactgtgagag
tcggccctgaagtcctatgaatcggaacaaccaagcgagcgtcattggacgagttaagacgcggatcggcaggccggacagcagcgaatagcattcacac
aggacgcgcaacagggttgatatttacttctcaacaacactgtggttcaaatcgttgggcttcagggcgcagccgatgaacttcaccggcatacacacca
cgtcgtggacgtgagcgagcatacctgagatgacccagtcgctggcatacacgattacgacggattctcgacttgcgtcgaactacttcagcatcGGGGT
TCCGCCCAGCTTGGCCTTGAGTGCGGCGAAGTCATGTGTAGCGTGGATTCATTTTCCTGCTCGCGATCTTCGGGCTTTGCGACGTAATCATCAAAGGCTG
TCTCCGtcagcgagtacaacgcggtcgcgtagatcgcgaaatcggcgagaaaccggtggtagtagttatggctacctaggaaagactgcagaccattgac
cgtgcaagggaattccagcgtcttgagtgacttgaggttcttAGACTTCGCATGGAGGCCGTGCTCCGACTATATGTGGCCCGGGTAGTCGACCTGGGAC
ATTCGCCACTCACCCTTCTCTACGCTGATGACCAAGTGCCACCGTTCGCAAACATCAGGCAAGTGCTCGACTTTCTCCCATAGATCGCCCTACGTCGTAC
CGCCAATCAGAATGTCATCGATGTATGACACTCGTCCCAAGACGGGGTGGATCCGTGAGGCTTTCGGTTCTCCATCCTCGACGTCCCTGGTACTGCCGTC
CGGGGACAGCTTCAAGAACCCATTGAGCGCGTTGTCAAGCAGCATTTGGTA