Description :
From Genome Similarity Track
Location :
contig_8:815228- 816703
Transcript NameFunction/comments
g1956.t1RAW24380.1 Phosphoethanolamine [Phytophthora cactorum

Sequence
1475 bases(100 bases per row)
CAAGACCATCAAGCACACCTCGGCTGACAACAACGACCATTCCGTCGCCACCTTCCAGAAGTTCCTCGACGAACAGCAGTACTCCAGCCAGAGTATCACA
CGCTACGAGAAGATCTTTGGACAGGGATACGTGAGCACCGGAGGACAGACCACCACGACCGAGTTTGTCGAGAAACTCAACCTCAAGCCCGGTGAGCGCG
TGCTCGACGTGGGCTGCGGCATCGGTGGCGGCGATTTCTACATGGCTCGACAGTTCGGTGTCTCCGTCGTCGGCATCGACCTCTCCACCAACATGGTGCA
CCGCGCGCTCGAGACGTCGATGCAAGACGCGAGCGCAGATGTCGAGTTCGAGATCTGCGATGCCACTGAGAAGGAATTCCCGGACGCCTCCTTCGACGTC
GTCTACTCTCGCGACACGATCCTGCACATCGAGGACAAGCAGGCGCTGTTCGCCAAGTTCTTCCGCTGGCTCAAGCCTGGCGGTCGCGTCTTGATCTCCG
ACTACTGCCAGGGCGAGCAGGATCCCACCGACCGCTTCAAGGCGTACGTGGCAGGCCGCGGTTACCACCTGCTGTCTCCGTCGCAGTACGGCAAGGTGTT
GGAGTCCGTGGGTTTCACGTCTGTCGTGGCGGAGGACCGCACGCAGCACTTCGTGGAGGTGTTGAAGGAGGAACTGGGTCGTACGTTGGCACACAAGGAT
GAATTCGTGTCGGAGACGAGCGAGTCGGATTTCAAGTACATCGTGGACGGCTGGGAGGCGAAGATTGTTCGTTGCGGCGAGGGAGACCAGAAGTGGGGAC
TGTTCTACGGCAAGAAGGCATAGTTTTAGGCTTTGATCCTGCTAGGATCGTAGATAGTTTCGCCCAGCAGGAAGCCTGAATAAAAGAGTAGTTTCGATTG
AACAAGTTGACCAACTCCGTAAGGCTTCAGCTGGGCCGTACCGTATCATCGTCAATCTTGCTGCGTGCGGTCTTCTTTAGACGATACTCCGGTATCGACG
GCATCGTGGTCGAGTTGCAAAGCTTGACACGACGACCAGAGCTACATGACGTCACTTGCACTGCTGCGGGCCTCTTCTCGTACGCAGAAGTGCTGCGAGC
CAATCCAGCGCGGCCAACGCATGTAAATGAAGGCACTCTGCGTGAAGAAAGGGATTTCCGCCGCCAAGCTCGAAGGTGACGCAGAAGACTCGGTTTTCCA
TTCCGAGGCCAGTCCAACGACAGCCACACGCAAAGTGATCCACGGCGGTAATTGCCGGTGCGATGGCTCGCCTCTGCAATCGAATCTTGTAATTTCGCAG
CAAGCCTCAACAATGCGCTGAAGTTGCCGGACGAAATTCAAGGGTGATGGACGGCACATCGAACACGCAGTTGCCACATCGAGGTGCGTCCAGTATTCGG
TTTCTCACGGTAATGATTACTTATATCTATATTTTTGTAAGAGGCCGACAAAATGAATGCGAATTAATCCCCCAA