Description :
From Genome Similarity Track
Location :
Scaffold_22:81512- 87148
Sequence
5636 bases(100 bases per row)
AGTAGCTAACAAAACCAATGAACCCTTCTTGAATTCATTTGTGTTCCCCCTGCCAACGTTGTCTGCGTTCAGCTTCTGTCGATCAACAGAAGCTGCAATA
GCGTCTTGGACAAATCGAATGACGGCTTGTCTGCGCTGCACGAAGTTGATCGCGTCCGAGCTGAACTCGTTCAGCTCGTTTCTAGCAATAGGCCCGGCCT
CTGCGTTCGTCTTCGCGGTGTCTGGGCCCTGCACAGACCCGTTCTTCTTCATCTTCTTCTTCTTGCTCTTGTCGGTGTCTGTGCCCTGCACAGACGCGTG
CTTCTTGTTCTATTTGCGCGTAGTCGCGGCTGACACTGCGCAAGTGTCAGCGGCATTCTGCGGCTGCGATCCTCCCCCACTTAAGGAAGGAGCCACCATC
CCGAGTAGACTCGGGAGGCGTGGGGGCTTTATGACATTCACGTAGAACGGCGTATGCCCGGTCGAGGCATGTACCGAGTTGTTGATGGCGAACTCCGCCA
TCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCTATGAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTCTGCGG
ATGGTCCGCAGTCGACATTGAAAGTTGACTCCCAAGAAGTGTAAACACTTCGTGCCAAAGGTGTGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCG
ATCGACATGCCATAGTGTTTGAACACCATGTCAACGAACAGACGCGCCGTCTACTTCGCAGTCACTTCAGCGGGTACCGCAGCAAGATGTACCATCTTGC
TGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGGTTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACACGGACTGCCAACACTCTCGTGG
AGTTGGAAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGTTTCACATGTCGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTATACTGG
TGGGTCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGGTACTCATACATGTTCCTGAGTC
GGAGGTCATGGTCATTGGGCACGACAACGCGGTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCACCCGGTAACGGTGTGCACGAGC
ACGAAGATGCGTCGGCAGCTTCTGACGAGCTTTGCCAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTTGCGTCCGCGTCGTGCGCGTACGCGACCTTC
AGTCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTTATACGGACCACGCGTCGCTGCGGACGGCCGTGAAGTCGCCGCACATC
CCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAGCCCGGAAGACTCAATGTGGTGGTTGCGCTCAGCTGCC
TTCAGCTGGCGCGATTGGTAGTAGACGATACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGCCGGATGCGTCGCACACAA
CGTGGAACGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCATCGAAGGCCTGCTGACACTCAGCAATCCAATTCCACTCGG
CATCCTTCTTCAGGAGCTGTGACAGCGGGCGAATCGTGCCCGCATAGTCCTTCACATACTTGCACAATTACGTGACCAAGCCAAGGAACTGCCGCAGTTC
CTTGACGTTCGATGGGGTCGGCCACTCATTGATCACTCTGAACTTCTCAGGGTCAGGGCGGATACCATTCTTCCCAACGAGACACTCGAGCACGGGTATC
TCGCTCGTCCCGAAGGTGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATAAGTGCAAGCAGCCTCCGGAGATGTACCTTGCGCATCTCAACAT
TGCTCATCCCGTCCGCAGCCCAGCTGTGAAAGAACACATCGTCGAAGTAGCTTGGTGGGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTT
GAAGGTCGCAGGGGCGTACTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTTGGCGTGCTCACAGCCGTGAGAGGGATATCAATCTCA
CGCATGAGGATCTGATAGAATCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTATCGGCG
TCTGCACCGGTTTCGTCGCATCGTTCAGGTTGTTGTACGCATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGCCGGAGCACTGTGCGG
GGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGGGGCAGTGGCCACTGCCGCGTGACA
CAATACTTCGTCCCCGGCACGAGATCAATCTCGTGCTGGATGCCCTTGTCCTGCGGAAGTTCCGCAGGGATCTCTTCCGGAAGCACGTCCGCGTACTCCA
GTAAGATCTCGTAGAAGGGACTCGTCTTCAGCGAGTCCCAGCTCTGCTCCTCAAAGCGCTCCTTCTCAGTCTTCGCACTGAGAGTGTCCTCACTCTCAGT
GGTGGCCTCCATGAAGAACTGCCTCAGTTCGTCATTCTCGCTCTTCGCCCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAG
TCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGATTAGCGAGAGTCATCTCCCTGTACCGGAACCCGG
CACAGGTACGCGTCGAGACGTTGAACGTCTCGACGTCCCGCTCCTCTGCCTCCGTCTGCCCGGCAGACATTTCTTGTAGCGTCTCGGCCCCAGGCCGAGA
CTTGCGCAGCAACCTTCGCATGCGCCGTCTTCTTGTTTTATGGAGTCCGGCTCCGCTTCGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCT
TCTTTTATACCGCCGGCGGGTACATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCACGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATG
CAAGTTTTTCCGGTGCAGGACGTTTGCAACCGTCCGCACCGCCTGCAGCGTCGGCTCCCGGAGCCGACACGCCATCCTCACCTCGACACCTGTTATTGGC
GGAGCCCTTTATTACAAGGGGTGCGTCGACTCCCGGAGTCGACGCGAAGTTCCTTTCGCAGCGCCGGTTCCCGGAACCGTCGCGACTTTAATACCTCGAC
GCCATCGACTCCCGGAGTCGACGGCGTTACGTCACATTGGCTCTTATTATTGGCCAGAACTGATCCGATCAGATTCGCGTCAGCATCCACGGCTGAGGTG
TGTGACTCGCCTGCGTCATCCGCGCCCTTCGGGGCCAGAGACGTTTCCTGATTCGCTGAAAAGCGGGTGTCGACCTCCGAGGCCAACAGATTTCCGTCAT
TAGCTGCTCTTGCGCGCGTGCTCGCGCGCGCCCAGGGCGGTCCGGGACAACGGGGTTAGGCGCTGTCTCGAGTGGGGAGTCGCGCTCACCTGTCGGTGCG
TGTGTTGCGGCAACAGGGCCATCGCTCGCTGTTCCCCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTACCAATCGATTACCGGATCATGCCGTGCAA
GCCACGGCATGCCCAATACAATGTCAAACTTACCGTCCAGGTCCAGGACGATAAAGGGTTCGACTAACTCTTGATCTTCATACGTGAAGCGCACGCGTAC
CATGCGCTTCTCGGTCTTCACGACGGCGCTCGTCGCCAGTCGTACTTCCAACATACTTCGAGGTATCATTAAATCCTCGAAGTCAAGCCTCGATAGACTT
CGCGTCGAATAAAGTTCTTCGACGCACCAGAATCTACCAAAGCGCGAAGAGAGCCGCTTGGTCTCATTTAGTTCACATTTGCTTGTCATCTTGGTTCTTG
CAGTGAGAATGAATCTCACTGGGTGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGACGACACGCGGAACCGCATTACCAGTAGGGCGCTCCGCGCCTACTG
GCGTCCAGCTTTTTTTGTTTGGTTGCGACGGTTCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCAAAGTGACTG
ACTCTACCGCAACGGTAGCATCGCACGTTGTTTCCCTGCGACTGCTGGGCTCCAGCAGTTGCAGCACTCGAGAGGTCCATGGGTTCTGGTCCTCCCGTCC
TCACTACCAGGCGTGGCTGTGGCCTCGGCACATGTGCGTGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTAATTGCAGCTTCGAG
AGTACTCGGGTACTCACGGAAGAGGTAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGGTTGGTC
ACGATGTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTGGAGGAACTCCGCCCTCGATCGGAACTCGT
TTTGCGGTGGCTCAAACGCTTGTCTGAGCTTATCCTTGAAACCCTCGTACGTGCTAAAGCACGTTGGTTCCGAGAGTCGGCGTCCATACGCCTAACTTCT
TGTACGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAAGGGGTCGACGATACGTCGAGCCGCAATGGCAGGGTCGAGTTCGACAAGCCAACAG
AGGAGATGTTCACCCTCTCTTCCGACATAGTTACTCACATTGATCTTCAGCGATTGCGTGCGTGGTGTCGTCCCGGCGGTAGTAGCAGCAACATCGCGTT
GCTCCTTCAGGATGAAACCCAGAGCAACACCGTGTTGCTCTGTCGACGTTAGCATACGCAGCATCGTAGCTACAGCCGCCTCAACAATGACTGTTGATAG
TTATTGGAGGACCTCCCACTCTGGATTCGACAGGTGGTGACAGTCAGCGCGTGCAACGTGAGTTGCAGGCGTAGTGGAGCTTTCCATGGGCACCTCTGTA
TCCATGGGAAGGTTCTCAGCTCCGCGTTCGTGCGGTGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGCC
TACCTTGGCTCACTACTTCAGGTTACACGTGTGCGCACGTGTGTGAGGATGCGTAGCTTAGTTTAAACTAGAGTTAATTATACTCGGGCGTCCGAGTATA
GATTAATCTAAATAAACGATCCAAATAATGTTCTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGCTTTCTGACTTCCTCTAAATGTAATATTCTA
AGTTAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAACAGATGCTGCTTTTAGCCAATAGGAATCCTAAGTC
TTTATGGACCACCCGTCGTGGTGATCGTGAATGTAT