Description :
From Genome Similarity Track
Location :
Scaffold_9:81506- 82690
Sequence
1184 bases(100 bases per row)
CGTCGTTGTGTCCGTCGCCACGGCCACCAACAAATGCAACATCTCGCTGGACGGCACGTCCACCTCCACCACGTCCTTGCTGTAGCTCAGTCTCTTGGCG
TGAGTGGTCAGCGAGTCGAAGGCGCTCGATCGCTTGCTCCCACGTAATGGACTCATCACGTCCAATACGTACTTCATGCTCGTTTACCACCGCTGGGTAC
ACACCCACTGTATTCGACAATAGGATAGAGACGGCTTCCTGCTCAGGCAGCTGCTTGTTCGCGCGGCGAAGTCTCTGTTGGTAGTCGTCGATGTCACGAA
TGTAATCGTCAAGTCGTTCGTCACGTTGCAGGCGACGATTCAGCATATCTCGCTTGAGAAACACGCTGTTTACTCCAGGATGGTTATCAAAATGATCTTC
CAGTGTTCGCCACAGTAGGATAGGATCAGCACGTTGAATAACACTTGTAAATCGCATCTGTAGTTCTTGACTAAGTCCCATCGTAAGTTCACGTTGAGCA
ACACGCAGTCGTTGCTTGAAACAGCCGCGCTGTCCTTCGTTACGTTGGTCTGCCATCGTTTCGCGCTCCATGATGGGGTCCAAGAGGTGTGCGACGTCGA
GAATGGAGCAAATCTCGACGCGCCACGTCTGGTAGTTGGTATCGGTAAGTCTTGCGTTCAACTGCACGTGTCCGCTCTGGTTCATGCACCGCGTGCATCT
GTGGTCTCCAACCATGGGTTCGTCCGTAGCGGAGTCGGTCCCGGCCTCGGTCTGGACTGGCTGCGCTGCAGCCTCGGACGTTCTTGGGTTTCTTGGCGGC
TCGCTCTGACGCGTGCTGGCGTCGGCGGTAAGTTCCTCTGTGCTTGGGTTTCCTCGGCGGGGCCCGTACGGCGTCGGCACTCGCTGCGGTTGTGCTCGAG
CCGCTGAGAATTCTTGAATGAGCTGCCTTTGTGGGCGTCGGGTAGATGCTTCCACTGGAATGTTCTGCACTTGCTGCTGATTGGTCAGTGTAGTCATAAC
AGTACCGAATTGGGCCAATAAGAGCTCGAGTTGTTGCTCAACTCGGGTTGATGACGCTTGTGACGTCGCATGTGCCTCGTCTGACGTTGTCTCGTCTGCT
CTTGCAGGTAACTGCAACTCGTCGGACGCGCGCGAGCTCTGCGTACTCCGGACTGGGCTTCCAGCTCTCCTTCTTGGGCTCATA