Description :
From Genome Similarity Track
Location :
Scaffold_174:81502- 85444
Transcript NameFunction/comments
Physo_144260reverse transcriptase

Sequence
3942 bases(100 bases per row)
CCTTGGTGTAGACGCACCAAAGGCTACATACATTTACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAAAGCAGCATTTTAG
CCAATGAGCGACATGCATAGCATTGGAATTCTGGCCACCAGCCGCTGGCAGATTCCTAACTTAGAATATTACATTTAGAGGAAGTCAGAAAGCATAAAAC
AAAAATAGCAGTTCTCATCTTTTACCAAAACCCGCTACTTGGAGTCTTTATCTTGTTGAAAGTAAACTCGTGGATCTCGAGTATACTTAATTCAAGTAAA
AGAAACCTACGCTTCCACATACACGTGCGCATTCGTGGAAGTCGTAGTAGTGAGCCAAGGTAGGCCCACTACACCTGGTAGCACTTAGTAGTCCGTCCAA
CGACCGACTACCTGAACGTTCGTACGGAGCTGTACGAACGAGGAGCCGAGAACCTTTTCATGAGCGCGGAGGGGCCCATGGAAAGCTCCACTTCGCCTGC
AACTCATGTTGCACGCGCTGACTGCCTCCACCTGTCGGATCCAGAGTGGGAGGCACTCCAACGACTGTCAACAATCATTGGGGAGGCGGCAGTAGCTGCG
ATGCTGCGTACGCTATCGCCGACAGAGCAACATGGTGTTGCTCTGGGGTTCATCATGAAGGAGCAGGGTGATGCTACTTCCTCTATCACGGTGGCGTCGG
GGACGACACCGCGCGAGCAATCGTTGAAGCTAAACGTGAGCAACTATGCCGGAAGAGAGGGCGAGCCTCTCCTCCGGTGGCTTGTCGAACTCGACATTGC
CATTGCAGCTCGACGTATCGTCGACCCGTTGTCCAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGAAGTTGGGCGTATGGGCGCCGACTC
TCTGATCCTACGTGCTTCTGCACGTACGAGGGTTTCAAGGAGGAGCTCAGACAAACATTTGAGCCCCCGCAAAACTAGTTCCGGTCGAGGGGAGAGTTCC
TCGACCTACAGCAGGTTAAGCATGATGTTCATGCTTACGCGCAGAGAGCACGGTATTTGGTCTCGAACATTGTGACCAACCCGATAGACGAGGCGACCAA
GGTCGTCACGTTCATGAAGGGTCTGTGAGATGGGCCTGTAAAGACCTATCTCTTCCGTGAGTACCCAGGCACTCTCGAAGCTGCGATTGCTCTTGCAATG
CAGGAGGAGTTTAGTCTGAGGCAGACTAAACTGCATGCGAATGCGCCGAGGCTGCAACCGCCTCCGGTCGCGATAGTGGGAGGTCCGGAACCAATGGACC
TCTCGAATGCAACGGCTGTTGGTTATCAACAGCAACAAGGAAGTAATGTACGATGCTTCCATTGCGGAAGGATCGGTCACTTTGCCCGAGAGTGCACGGC
ACCCGAGCACCGAGATGGTGGTCGACGCGGCGATGCCGGGCATCGTCGCGGACAAAAAAAAAAACGCTGGAACCCAGTAGGCGCGGGGCGCCCTACTGGT
GAAGCAGTCACGCATGTCCAACTCGGACATGCGACACTGAGGACTGCAGCCCTCAGTGACGACCCTTCTCACTGCAAAATGCATGATGAGAAACCGAACC
TTGTCATCTTGAACGTGTCTTCGAAGAGAGAGAGAGCAACTCATTTTGTGCTTTGGTTGATTCGGGCGCGTCGAACAACTTTGTTCGACTGCGAAGTCTA
TCAAGGCTTGACTTCGATGATTTAAAGATACCTCGAAGTATGTTGGAGGTACGACTGGCAACGAGTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCG
TGCGCTTCACGTATGAAGATCAAGAGTTTTTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGCAAGCCACG
GCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCG
TCAGATGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGAGCGCGCGCGAGCACGCGCGCAAGAGCAGCAAGCGTCGG
CGTCGCCGCCGACGGTTGAAGGAGAAAATGTGTGATCTCGGAGATCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGACCTCAAGGGGCACGGAA
AACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGTTTTGGCCAATAATAAGAGCCAAGGTGACGAAACGCCGTCGA
CTCCGGGAGTCGATGCTGCAGGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAAATCTTGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCC
TGGCGACCAAGCCGGGCTTGAAGTCGCTCGTCCGCGGGATATACCCGCCGGCGGTATACAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAA
GAACCAAGCGGAGCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGGTCGCTGCGCAAGTTTCGGCCTGGGGCCGAGACGCTACAAGAAATGTCTG
CCGGGCAGACGGGGGCTGAGAAGCCGGACGTCGAAACGTTGAACGTCTTGACGCGTACCTGTTCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAATCC
TCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCGTGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTC
TCGGACGCCGTGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGAGCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACTAAGA
AGGAGTGCTTTGAGGAGCAGAGCTGGGACTCGCTGAAAAGGAGTCCTTCTACGAGATTCTACGGGAGCACGCGGACGTGCTTCCGGAAGAGATCCCTGTG
GAGCTTCCGCAGGACAAGGGCATCCAACACGAGATTGATCTCGTGCCGGGCACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCG
AAGTGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAGGTGCGGGAATCGAAGTCCCCGCACAGTGCCCCGACGTTCTGTGTCAAGAAGCCACA
GGGCGGATGGCGCATCGTTCATGCATACAACAAGCTGAACGATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGTCATTATCAATTCGATG
GCCAGGAGCACTGTCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCACGCCGA
GCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCAGTTGTTGCGCTCGGTGCGCGA
CTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGTTGTCGAGATGCACAAGGTGCATCTCCGGAAGCTGCTT
GCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGA
CCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAATGTCAATGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTG
AAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAAAAGGACGCCGAGTGGAATTGGGCTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCA
AGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACC