Description :
From Genome Similarity Track
Location :
Scaffold_2111:815- 2646
Transcript NameFunction/comments
Phyta_totarag14116conserved hypothetical protein

Sequence
1831 bases(100 bases per row)
GACGAGAAGATCTGTTATCACGACGGCGGGAACCTGcacacagaagaagaagtccgaGGGTagatggtggtgctgcccGAAGTCGCCCTGACGACGGATA
AGATCATGATTAATCGAATTTAAATACGAGGTCCAGCGTTCAACTCACCACAAGAGATCGACTGCCTGCGCCAGAAGATCTGGATATACCGACATATGGC
CATCGGAAAAGGGAATGATTTACCATCCGCTACCAGGGCGACCTGTGCGAAATCGACGTGTAAAACGCTAAGCCGACTGTAAAAACCGATCGCACAGTGA
GTACGGAAGGTAGTTCCATAGTTCCGAGAAAATTTGTCGGATCTGATTAAAGGACTCCGGGTAACCAACATTCGACGGCTCGTTGGGCGTCACTCATAGC
GGTGATCACCACGCCAATGGGGTGGACAGTCGAATGCTCATTGATTATCAGCTGGTGTTAAGCCTCACAAAGGTTATGGTGTATCCGATGCCTGTGATTA
ATGATTTCTTGGAGGGACTCGACAAAATCTTATTATATTGTTCATTGGGAATGTTGAGTGGGTTCTGGGTAGTAAATGTGACGGGTTGAGACTGAGCGAC
CTCGGCTTTCATCACACCGTTCGGTCTATTCGAGTGGAACTGAATATCTTTCAGTCTCAAGCTCGCCCCGCAGATCTATCAACGGCTACTGGACAATGCA
CCACAGGGGTTCACTCGGATCTCGTGATCCGGTAACAATCGACAGATGTCGAATCTGttcgaagatggagatccaGGAGATCCGATTACGACGTAGATCT
TACATTGATGACATCTTAGTGATTGCCAGATCTTGAGATCAGACGTGAGATCGAGTAGACGTCCTGCTGGAGGCATGTAATAAGTGGAATCTGTGAATCA
CTAGGGCTCACCCAAACATACCTGGAGGACTTGAAGTTTATGGTATTCCCAGAACGGTTCGAACCATTCTGTCTTTCCTGGCAAGGTTTAATTAATATAG
CCGTTTCATCGAGGATTACGCGATATATGCAGCAGTGCTACATGAATTGTGCGAAGTCGAATTTGcgcgatgacgaagaaggacaaacGTCCACAGATCG
GGGAAAGATTTAAATACCCTGATCCGGATCTTGATCGGCCAGATCCAAAGACTAAATACCTGGAGGCGTATAGGCCAAGATCTCGAGAGCTGGATGCGTT
AGGTGTAGACGACCGTGATCAGCGATGGATTCATGCCTACGGATCATTTTGCAATTCTTAAGAAGAAGATCTCAAAGACTCCGATTTTGCGTTACTTTGA
TACGGATCTTCAATCAGTGGTGGTCGTACGCCAGTGGATAGACGATCGCAGCCGCTCTGATGCAAGATCAcgacggaattcacaatcGGGTTACCTTTGC
AAGTTGAACCTTAAAGTGAAATGCATGAACTACGGTGTGGTCGCGAAAGAAGTGTTGATTTTCGTTACAGATGTTGGGTCTGTACTACGCCATGCTGGTA
GGATGACTAATGTGGATCTTGACCTGACATTCGATGTTGGCACCCAGGGGCAACTAGGGCAGTAGCCAGCGTTGTTGCCACCATGAACGCTTAAGATCAT
GAGGTCCACTAAAGGGGAAGGCGAAAGCATGGGGGGGCTAGCTGCCAGTATAACTCCGAGATCCAACGTGGACACGGCCTTAATCTTGATCGCTCTATTC
GTGGAGAGCTTTGACGGGTCCGGTAGGGTCAAGAGACGTAAAGCCGCGTTCATCGCGATCATGTGGCAATTGCCAGATCGGACGGTTGGCAAGGCCAGAT
CTGACAACGCTGGAAATCTAACGGTGAACGA