Description :
From Genome Similarity Track
Location :
scaffold_32:81455- 82736
Sequence
1281 bases(100 bases per row)
GAATACAAGGATGACGTCCTAGTGCAAAGCCGCCCTCTGGTCTTCCACCAGAAAATGGATCTCAACACGGAATGGATCGTGAACTTGGTTCAGAGCATAC
AGTGCTTTGACAGTGGCCACTGATTGAGCGAAATGAGTATATTGATGAGTTCTTTGCTCAAAACAAGCTGCTGGCTGGGTGAGGGAGAGCAAGTCCCCTC
ACAGCCAACGTTTTGTATGCGTACAACAAATTGTGAGTTGCGTATTGTTCAAGAATATAACAAGGTAAATGCGCAGTCGTTTCCCGCTGAAACGCCGATT
CCGCGTAAAGATGTCATCATCCACCGTATATCCGGCTGTTCACAGTTTATTGTACATGATTTGGCtgatggatactaccaaaTCTGGATGACGGAGGACG
ACCTACATTTGATGACTGTTAGTAAACCGTCCGGTAGTGGCTTTTGTTAACACAAAGACTATCCGATGCCCCAGCAACATCCAATCAATTTGACTCCCAT
CTGTTTTTACCACTACGCCGCTTCGCACAAACCTATTTTGATGATATAGTCGTTCATTCGAAGGATAAAGATGGCAGATCTGTCGGAAAAGTGCACTAAG
AGCACCTCCGTGTGGTGCTGGAATATATACGTGAACATTCACTGCAAGCGAATCTTGCAAAGTGTATTTTCGGTGCTAATGAAGTCGGTTGTTATGTTGG
TGAACACGGCGCTTGAGCAGACCCTGAGGAggtcaaagcaatcgtggAGTGTTCAACGCTACAGAATTAAAAGGATTTGAGGAAATGGATTGATTTGCCC
AGTTACCTGCAAGTATTCTCGCGTAGCTACGCGGATTGGTACGCCCAAtatcaaacttgctgaacCATGGGAGTGGTCATCCACCTGTGAAGAGCATTCA
TTTATTGTCGTATAGATGATACGAAGCCGTATAGCGTGgtgtgtgacgcttctgTATTTGCGATTGGTTGTGCACTATTGCTAAAAGACTCAGAAAGACG
TGTCGTTTCAATCGCGACAACTGAAGCCAACACAAAAGAACAACCCTGCCCACGGCAAGGAGCTTTTGGCTCTGGTGAAGTTTCGTGTTCGCTTCTTGGG
CTCAACACCGTTTGTCGTCTTCACGGATCCCGCAAGCTGGCGATATGCTGTTCAGTCTCTTCACTTGTCACATCAGATGGGTCGCTTGTTGtctttcttc
gcagaatataacttcacgGTCGCGTACAAGCCGGGAAGCTGAACGTGCTGGCTGACAcattgtcacgtcgtcctggttatg