Description :
From Genome Similarity Track
Location :
Scaffold_593:8145- 11535
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_593-fgenesh-gene-0.43'5'-cyclic nucleotide phosphodiesterase

Sequence
3390 bases(100 bases per row)
GCGTCGCTCGAGAGCCGGTCGAACTCGAGCTTGTACTGATCAAAGTTGTGCTCGAGCGCGTCGACATACACGCGCAACGCGGGGCACAGCGTGGCGAGCG
GCAGCCACAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCTGCACGGTCACGCGCGCCTTGATGTGGTGCAGGTTGGCCATGAAC
GAGTCCACGGACATCAGCAGCTCCTGCTCGTGCTTGGCCTGCGCCTGGAACTCGGTCAGCATGCGCATCCCCCAGCGCGCGGCCTGCGAGTACGGCAGCG
CCTGGCCCGACAGGTCCGCTGCGTGCATTACAACCCCCATGAGCACGTACTTCTTCTCCGGGAGCTGGCGGCGCGTCAGCAGGTCGAGCGCCTTGCACTT
GTCCACGTGCTTGGTCATGTCGGTCGCGAGGATGCACTGAATGATCAGCCTTCGCGCTCGCACAAACCTCGCGGGCGACAGGTGCTCGAGGATGTTGGCC
GACTTGTGTCCCAGGATGAGGAACGTCACGCGGCAGTGGTGGCGCTCCAGCACGGCGTCGTCGTTGTGAGTGAGCGCAATTTGGCTGCGCGCCTTGAGCT
CAAAGTCGTTCGTGTTGCCAGGGTGGTCAATGTCGTGGCACAGTGCCGCAAGCAGCATCACCAGCATGTCCAATGCAGAGAACCAGCGACCGCAGTCGCG
TCGTAGCAGCACCGACGTCGCATGCAGCACCTGGAACGCGTGCTGCAGGTTGTGGAATGGGTTGGCGCGGTAGTGGGTCGCGACATGCGACACAAACGTC
GCGAACTTGTCGGGTGACACACGGAACGCCTCCAGCAACCCGAACGTGCGGAATATGACGCCAGTCGCCACCGAAATGGCACCAGGCGACAGGTCCAAGC
AGTCGAGGTCCCACGCCTCAAGGTCGCCGACGCCAGTCACAACACTGCTCTCACGTCCCATGCCGGCCAACTTCAGTGGCACTCCCAGCGTCTCGTCACT
TGCCGGCTCGAACACGCTGAAGTCGACAAGACCGTCGTCCACAGCATCGCCGAGATCCAGTACAAGACCGCCGTCCACCTCGCCAGGCTGGCAGTACTTG
TGCACGAGCGACGAGATGATCTGTGCCTCGCTCATGGGTTCTGGACTCGCCATATTGACCACGGACGCCGCCGTCGGTCGATCACCTGATGATCCAGCTT
GTTCACGCTCCTTCAACGCGTCGCCGTCCGTATCGCTCTGCAGCCCGCAGTCCGACACGACCTTGTAGTAGGAAATGTCGAGCGAGAGTCGGCCGAGTGC
AAACTGGATCTCGCGACAGAAGCGCGTCATGCTCGCCATGTCAGTCGACGTAAACGGCACGACGTGTGTGCCTTCCAGCTTGTTGATGCCCATGGCGACC
GCCACGATCTTGGGGTGTACCGATGTGTGGTCTTCGAACACGGGCATGCACAGCACGCTCGTCGTGCGGTATCCCGTCTTGCGATCCAGTGTCGGGTCAA
AGAGCTCGTGAGTGTACGCGTCGCGAACACACAACGTTTCGCCTGTCGTGGCCACGAGTCCCGAGAGTCCCTTGCTCAGAGGCATGCGCACATTCTGGCC
GTCGACATGTGTGATCCACAGCTCTTTCTTGAGATCGTCCACGAGGAGGAAACCAAAGCGGTCGCAACCCATCAGGCGTTTGCCCTCCGCCATGACAACG
CCAACGAACTCGGTCACCGACGTCGAGCGCGCAACAAAATCCGCGAGCTTCAGCCGTGCCTCGGTGATGCGTTGGGATGTGATCACTTGCCGCAACAGGT
TCGCTTTGTGCAAAGAGATGCCTGCGCCGTCCGCCACATAGTTGAGGTAGAGCGCGTCTTCAGGCGAGAACTCGTCTCCGTTGACCTTGTTGGACGCGCA
AATAACAGCCAGCACGTTCGAGTCGGCGTCTTTGACTGGTGCACACAATACTTGGCGAGTCAGGAATGACATCTTCTCGTCATAGGTCGGGTCGAACTCC
GGGTGACTCTGTGCAAAATTGGTCAGTATGAGCTGCCCCGTGCGCATGACGAACCCCACGATGCCGTTGTGCTCGGTCAGGTACTCGTCCTTGGCGCCGA
GCGAGCTGTGGCTGCCGGCGATGTAGAACACGTTCGTGCCTTCGTCGCGGACATACAACACAATCTTCTCGGCGTTTAGCAGTTCGTACGAGACGGCGAT
GATCTGCGCCAGCACGGCCGATGTGTTTACCTCTGCCGAGATATTGCGGTTGAGCTTGATCAGGCACTCAATGCGGCTCTGCGCAAGCTGGTGCGACTTG
GCGAGCGAGATGTTCCAGATGGCCGTGCCCGTGATGGAGCAAATGTAGCTGAAGCTCTCCTTCTCCTCAGCAGATAGAGCTCCGCTTCGCTTGCTAGTGC
CGTTGGCGTCTGCGTCTCCGGGTGTGTCAGCGCATAGTCCGAGCGACACGTGCGGATGTTTGCGCGTTACAACTTGAAATACGCCGACTAGGATACCGTG
CGCATTCAGAATCGGAGCACACAACAGCCCATCCGGCACAAAATCTAGCAGCTCAAGCTGATCCTCAAACAGCTCGAACGTGTTCGAGTTGCTCACGTCG
GTCGCCTCGAGCGGTTTGCCAGTCTACCGCAGACCAGAGCCACAGTGAGATACGACCAAAATGGAGGATGAAGAGCAAGCGACTGCATACCAGCACAACG
CGACCGAACGTCGTGGTTGAGTCAACCGGCAGGGAACCTTCTTCCATATAGCTCTGGTCGGGGAGATCCACAGGCGGGTTCGAATAGAGCTCGACGGCGT
CCTTCTTCTCATTCAGAACCCCGAGCGTGTACTTCTCGGCGCTCACCGTGCTCTGCACCGCGTGCAGTGCACGACTCACGACCTCGAGGGTGTCGTTCGT
CTGCGAGATCTCGCGTGCTGCGTCCATCAGCGCGCGCAGCTGGTCAGCACCAGCACCACTCGTGAGTCGACTACAATCGGCACTACTATCAACACAATGG
ATCAGCTCGTACATTGTCTTCGCGCGCAGCAAGACGCGCCAACTCCTGCGTTTGCTCGTCAATGCGATCGCGAATGCCGGACGAAAAGTGATCGCTGTGC
GACCGATTGCGATTGGGTAACGACTTGTTGTTCCGCTGACGCCGCATCGACGACGTTGTGCGCGATGGTGGTCCTCCGCGAAGTCCCGGACTCGCCACGT
CACTGCGGAACGCCATGCACCGCTCCAGCTGCACTTGCCGTTTCGCGAGCTTGAGTTCGAGCTCCTTGGCTTCGTCCACGGCACGCGCGAGCTCATCCTG
AAGCCGCTGTTTCTCGGCAAGTCCCTCCCGCACGCTTGTCACGACCGCTCTTAGGGCTTCCGACGGCACACGAAGCAGCTTGGATTCGTC