Description :
From Genome Similarity Track
Location :
Scaffold_280:8145- 10683
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_280-fgenesh-gene-0.0Chloride Channel (ClC) Family
Pytar_ATCC12531maker-par_contig_280-fgenesh-gene-0.4Conserved gene of unknown function

Sequence
2538 bases(100 bases per row)
CGCTCGCTTCCGTCATTGGCGAAGAAGACGAGTTCAAGCGCGTGAGCCAAGAGCTACAGCAGCTAGTGACTCACCTCAGCGAGAGCAAAGCCGACAAAAA
GGAGCTGCTCGAAGTCAAAGAGCAAGTGCTGTACGACTCGCGCGTGCGGCAGCAAGTCGAAAACCTGCGGGCGTTCATCGACCTCAAGATGAACCGCGAC
GACGTGTTCTCGGCGCTCAAGAATAAGGCCGACAAGGACGAGATGGTCGCGCTGCTCAAGTCGCTGTCCGAGTCCATGAATGCGTCCGTGCAGCAGGCTC
AGCGGTCGTTCACCGAGGCCGAAAGCGCCTTCCTCACGAGCAAGCACGTGGCGGTGGCGGGCGGAGGAGGCGGTGCCACGCCACTTTCTCGACGTGGGAA
TGTCTTGCCGAGCCTCGATAAAGAGCGGTGTCTGTCCTGTAACAGCGTGATCCGCGATTCGCCCCACGGAGCCCATAGCAACAGCAACAAGACCCCGCAG
CCGATGGCGCCTGTGTTTGGCGGTGGCTTCCAGGTCGCGTCGATGGGACCGGCGCTTCTCAATGGGCCCAAGCAGTCCAACAACAACCACCTCGATAGTC
TCGCACGAAGCAACTCCTTCGGCGGAAGCGGAGGCGCGCGAACAGGAGTCGGAGGTCTGAACGAAAGCTCGAGTGAAGGGTGGGCCATCGTCATCTCTAC
ACGTGGTGGGGATTTGGAGGGAGCTAACAAAAGGGTCGTGTTTTTGTTGTCTCTAGGTTTTTGCTGGGTGCCGACGGCCACGTGTACCAGGGGGATCCGG
CACTGTTGGCTGCGGTTCAGCAAGAACGAACACCGTCGAAAGTTGCGCCTGTTATAAGGCTTCCGCCAGCAGCAGGCGCCCAGCGACGGCACATACCCAC
ACAATCGGACGGACCCGCCACAGAAAGCGACAATTCCTAGAGTCAATAAGCGTCTGATATTTAGCCCAAACCTTTCAGAACATCGTCATGTCGTCCATGA
GCATGTCCTCGCCCTCGAGCTTCATGGGCACGGCGATGCCATCATCCAACGAATCAATGCCTTCACAATCAGCCCCTCCCGCCACGCCCGCAGCCCCAGT
GGCAACACCAGCAACCCCACTCGCTCCTCCTGAAGCGGCCGAACTGGACTGCTGGATGGCTTGCTGGAGAGCAAAGTACGTGACGAGTGGCACCGAGTGG
CAGGAGTCCGTGAGCTGCTGCATCATACTTGCATCCAGCATCGATGGCGCCATGACTGCCTCCGTCTTTGGGGTGGCAGCATCGTCCACGGGTTTCACAG
CCAACGCGAGAGAGCAGTCCGAGTTGGTCGTAAACTCCACCAGCATAGGCGCTTCCATGCCCACCACTGAGTCAATCTTCAGTGTGATGCGTTCAGGAGC
AGCGACGTCCACCTTGATAGGCACTGCACAGTAAAATGGATTAGATAACTATGCACTCATAATGCATAGGTAGACGAGACTCACCTTGAAGAACGTCTTC
AATATCGGCCGCGATGCGTCTACCAAACGCGATGTTCTTGGAGGCAAACGCACTAAAGAGAACAGAATGGAAGAAGAGACTGTGTCCACAGATCTGGAAA
ACTTGCGTGAGGGTCGACGGCGAAGCGTGTACCAACTACATGTCCGATTTAGGCCCAACGTTAGGAGATAAGGTACATACATTCAAACACTGAGGGCGAG
TCACGAGACGTACCGGAATGGGGAACGCATGGAGTTGCAGGCCGCCAGAGATTTCTTTGGTCACAAGCGAGTACTCTTGTCGCATGGGTGAGCCCGATGG
TGGCGACACGGAGCAGACGCTGTGGTCCCGTGTGAAATGGAGCTGCGGCGTGATGTACTTGCGCGCTTCTCCCTCTTGTCCACTTGGCGACGACGAGGAC
GAAGTGCTCCAGCTCACGAACTCGTTAAAGAGCTTCTCATCGTCTTGCGGCGCCGTCGGAAGCGTGGACGCGAACGCAGCTGCCGCCGTGGGAGCGGCGT
CAGCGTCTTCGGGCTTGCGCATGATCGCGAGCGCGAGTCGACGCGCCTGGACACCGGCCATGACCAGCGGCGTGTAGCCCGTGACTTGGAGCGCGACTTC
GTTGCGCCACTCGATAAAGCTCACACTGCCCGACCACTCGCCATGGGTGAGCGGATTACTGTTCTGCGTCTCCCCATCCGATGAAGCGGTGCTATCCTCC
GCGCGTGGGGTTCCCCTGCCCGCAGCTGAGGCCACGTCTGGTGCGTTCGCCTCGTCCACGCGCATCTTCTTCCGCGGCGGTTCGACCACGACGGGCAGGC
AGTGGAGTGCGTCCTTGAACAGAATGTCGATGCCATCCACGGCGCGCTTGACCGTCCAGCAATTGTGCGTCACGCATGCGTCGCTGAGCGTCGTGTACAT
CTCCTCCTCGAGCTGCTCGAAATTCACTACAAAACAAAGTACAAAGAATGAGGCTCACACAGAGAAGCGCAGAGGCATCAGCCGTGGAGAACGAACCTGC
CGGGAATCGCACCGCCAGTTCGGCCCGATTGATCAGGC