Description :
From Genome Similarity Track
Location :
Scaffold_88:81433- 83238
Sequence
1805 bases(100 bases per row)
CGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACATGAACGAGTCATCGTTCCAGTCCAGGCAGCTCAAAGTCGCCGAGCGAAACTACCCTAT
CCACGACAAGGAACTCCTGGCAATGCAATATGCCCTTGTAAAGTTTCGTGTTCACCTTCCGGGCTCTCGGCCCTTCGTGATCTACACAGACCACGCATCC
TTGAGGACGGCGACTAACTCGCTTCACCTATCCCAAAGGATGGCGAGGTGGCTGTTCTTCTTCGCGGAGTACAACTTCCGCGCCGAATACAAGCCGGGCA
AGCTCAACGTGCTTGCAGACGCCCTCTCTCGGCGTCCTGACTATGAGTTGGCCCACATCACACGGGTGACAATGAATCTATATGATCGGATACGCATGGT
GTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGCTCCTTATGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATAGGAGTTGAAG
GATGGCCTTCTCTACTACCGGGTGGAGCCCAATGAACCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGATATCCTCGCAGAGGCGCACG
ACGCGCCCTCCAGCGGCCACTTGGGTCGCGAGAAGACCTTTCTGTCGGTCGGTCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTAC
GCTAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGA
GTCTTGACTTCATCTTTGGGCTTCCCGATGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCGGTTCC
CGTCACTGGTATGGGCGAACAAACCGCAAGGTTCTTCGTTGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCGCGGACCGAGACCCGCGG
TTCACGGCTGCGTTTTGGAAAACGCTGTTTCCTTTACTGAGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAGACAGAGCGCG
TCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGC
GGTGCACGCGTCTACGGTGCTCACGCCGCTCTACTTGAACGGCTTCCGTCACCCCAGAGTGCCTCTCACGCTTCGAGGAGACACTGACTCCTCTATTCTA
AGTGGGGGAGAAGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGATACCAGTTTCGCCGGAAACAAGTGGAATCCTTTATGGATACCAAGCTGAGC
GTTGCCAGCAGGGTCCGCGATGACATGGCAGCGGCGCAAGATAAACAAAAGGAGTACTCCGACAAACATTGAAGAGTGAACTTAAGTGTATTTAAAGTGG
GGGGCTTAGTGTTACTAGACACGAGGAGCCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCGATAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGT
CCTGGCCAGACATGGTGCGTCCTACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGATCCG
CAGGGGGTTGCTGACTCGCAGACCCACCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTC
AGTCG