Description :
From Genome Similarity Track
Location :
Scaffold_16:81427- 82651
Transcript NameFunction/comments
Physo_113851kinesin family member 3B

Sequence
1224 bases(100 bases per row)
TGCTCGCTATAGATGGCCATTTTGAACATCATCAAGCTCGCTCGCTTCAGCGAAAAGCTGACGTCGGACGCGGGTGTATGTAAGATGACAGCCCAGCTGG
GCCTCGGTGTCTCGGGGCAATGCCAGAGTCGTCACCTTCTGGCGAAAGTGATGCCTTCAGGCTGGACGCGAAACGCGTCAAGCTGAGCTACATCCGCGTC
CGAGGAATCGCTTGGCGCCATCCCCGCCTCAAGCTGTCGATGTGTAGCGCCAGCCGCCATCGCGCAGTCGGACGCCGGCCAAGTTCCGCTGCAGCAGAAG
GGGTCGTCGTGCATCTGAAGATTTCGATTCTGCCTCCGAGCAAATCCTGCGTCGCATCCGAGCGCTGCTCAAGGCGCGGACAATTCTGTCAAACAGCGCG
TGGGAGGGATCGAGCGCCTCCGAGTCTCCAAGATGGAGATGGTCTTGGCCCGCAACGAGCGAGTTTCGAGTTTGCTCGCTTCCGTCAAGGCCACAGCGTC
ATCGGGATGCTGAGACCGACGCGGGGCTATCCCTCCCCTCCTCAGCCGCAAACCACAAGACCTGCACAAGGCGGCGACACACGAGCTGGGTACCTAACGT
CCACGCTGCAGTTTACGTACAGGAGACGAAGCAAGCCGAGGCTTGCACGTTGCAGTTGCAGTGCTCGGCCTGGCGCTCGCCCGCTGCTTGGATTGCGAGC
GGGTCGCGCTGCGCTGCAGCTTCGATGACATCAATCAACCATCGGAGCCCTCGCGTTCGTGGCGATCGGACGTGAGACCGATATGACTCCGTTTCGAGGA
GGCTCTCAGGAACCGGCGGCGGTTTTGAGGCCCCACCGGTCGTCGGGGGCCAATTCCAGTGAGCTCCGCCTTGTCCCCAAGTAGCGTCGTGGGCCATGGC
GACCAAGTCTTCCAAGAACGATGAGTGCGTGCGCGTGATGGTCCGCATCCGGCCCATGAGCGGCAAGGAGGTGCAGGACGGGCGGCAGGAGGTCACGACG
GCCAACTTCGACCGCGCCGAGGTGTCCATCATCAACCCCGTGGCGGCGTCTTCCGAGCCGCCAAAGTCCTTCACGTTCGACGCGGCTTTCGGGGCGCAGT
CCACACAGCAGCAGGTGTACGACACGGCGGCCACGGAGATCGTCGAGGCCGTCATGGAGGGCTACAACGGCACCATCTTCGCCTACGGCCAGACGGGGGC
AGGCAAGTCGCACACCATGGAGGG