Description :
From Genome Similarity Track
Location :
Scaffold_347:8141- 10449
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_347-abinit-gene-0.29NudC domain-containing protein 2
Pytul_var.sporangiiferummaker-pug3_contig_347-snap-gene-0.17Ring finger protein 8

Sequence
2308 bases(100 bases per row)
CTCACGAGTATTTCACACCGCCCATAAACGTACGCGGATCCGGTGCTGAGCCATTGAACTCGGCGCCGGAGAAGTCGAAGCCCGGGTTTTCTTCCTGGAA
CCGCTCCAACATCATCTGGCGTTTGGTCGCTTCTTGGGCCATCGGGTCCAACTGGAACCACAAAACGCCCACAAAAGTCGTATACGTCAGTCCGTTGATA
ATCAAGATTCAAGTAGCGATTATTCTGTTGTACCTCGCCGTGGCCCACAAACACACTTGGCCACATCAATCCTTTCTTCATTTTCTGCAGATTGATTGTC
AGCTCACCTTGATCTGCAACCCATAACGCTACAGGTTAAAGCTACGCACATTCCATAAAATACAGGCAACAAAAGCGCCTTACCAAGCATCCAGTAGCTC
TCCGCAACAACCACAGAGCTGGAGAGATCGTGCTGCGCACAGACGATCACATGAGCTATATTCTTGCTTTTTTGGTGCGCAGTTTCCACAACCAACGCGT
ACTTACATTGAGAAACTTGTCCGTTGTGCCGCGCAGGCCCAGCGTGACGTGGTTTGCAGAGATCTCGCATAGAATCATGTTCGCCGTGATGCCCGGCGGC
GGGCGGATGTACACATTGAGCTCTTCGAGGGATTGCTCCCACTCGTAGATCACTTGGTCTACGTAACAACAGCAGCAGCCGATACTCAGTGGTACGTATA
CAAGAGCTAGCATTCCATCCTTATGTGTGCAATAGCTCCCACCGTTGTGCTTAAATACTCGTCGCTCAACGGCAGTCATCTCTCTCTCTCTCTCTCTCTC
GTCGCTTTGCCGCGTTCTTCTAATGAGCGTGTTTGTTTGCTTCTAAACTCTACGCTGGGGCACGTCCGCTTGCTGCCACCTTCGCGCAACCTTCGCGCCG
CTTCAGCACCAATGTGATGGGATGATGCATCATGTGACTCAACCGAAATGCAGGAAAATCTTGAGCCGATGGTCGCCTTCGTCCCGCACACGCTCGTACG
GCCACCAGTCCAGCAGCAGGTTCTGCATCGCGATGGCCGTCTGCGACGTCGACGCGCGCACCATCGTCTCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGACTCCAACGAGTAAACACA
TTCGGTAATGACTCACTTGTCGAGCTGCTTGTACGGGTGACAGTATTGGAGGAGGTAGTACGAGTTGGAGTGGTCGTGCGTGGGGAATCGCTAAGAAACG
GGCTGCGGAATGGGGATGCGGACGATTGCGGTCGTGGCTCTGGCTGCGGTTCGCGTGTCTGCAGTTGGGACTGAAACTGCATTCGCTTGGCAATGAGTGC
CTTGTATGCGTCTGTCTCACCTACGAGCCGCTGCACAAGATCGTCCAATGCGCGATTTCGCACAGGTAGAGTCTTCACGTCTGTCCGGCAGTGAGGGCAC
GACAGAGACGCGCGGAACCAGTTGCTCACGCAAAACCCGCAAAACGTGTGCGAGCACGGGAGCGTCACGCTCGAGTGGAAGTACTCGAAGCAAATCGGGC
ACACCATGCACCGCTCTTGGTCGTCCAGCTCCTCCAGACGTCGAGTCCGCTTGCGGCGAACCACTTCTTCATCCGCATTCTCCATAAGCTCGTTGTTGTC
GCTGCTAGTGTGCCTACCATAGCGTCGCTCGCTTGTATCTCCTCTTTGATATCGCTCTCGCTTCGTTGTAACTGTACTGCTCGAGTACCGAGGCGTAGTA
CTCGTATGTGAAGTCGGGGTCTCGAATCCCAATCTCCTCACCGTCCCATTCGCACTCGATTGATTCGAGCTTCTCCGCTCTGGAGTCGGCGTTGACGTCG
CCGTTTGCTCCACAAGTTTCACATGGATACTCGAACTATCTTCATACGGGAAGTGGACTGTTATCCGCACGCCATGGCGCATCATCGACGCCAACACCAC
CTCATCGCCATCGTGCAGTTCCGCACACCCGCTGAGCGGTAAATCGAAGCCATTCAGCGACGTGCCATTCATTGCTTCCAGGTCCTGAAGCATCCAGCGC
GTCGCTTTGCGATCGTACGCCGTGCTGCCTCGGTGTGTAGAAAAGCTTGTCGGTGATGCAATGTTGATGCTACTGCTGCGGCCACTGTCTCGCACGGGGA
AGATGCGCACGTGCGCTTTGCTAATCGTGCGCGTCTTGTCCGTGGTCGGGATCACGACGTCGCTGCTGCGGCTCCGGCCAATCGTGAACGCGTGCACGAA
GGACCAGA