Description :
From Genome Similarity Track
Location :
Scaffold_20:8141- 9167
Transcript NameFunction/comments
Phyra_76717hybrid signal transduction histidine kinase putative

Sequence
1026 bases(100 bases per row)
ACTAGGCCGACCGCTGTCCTGGTTATCATCGTTGTTGCCCAAACTCAAGGCGGCACCGCCAAAAAGGCCGGTCAACTTGTCTCCATTCCCATCGCTCATA
CGTCGCCTGGACATGGTGATCTTGCTCTGCTATCTTTGATGGGTCTAGGAGTTTCGTGTGTGCATGCAATTTACTGAAAAATATTCCTTTATCAACTTAC
TCATAGACATACATCAAGCTGCAGCTCCGGCCACTGCAGACTTATTTACATAACGCAGCATGGGCCAGCCGGTTTGTCTTGGTTGCCAAGCTGCTCATCT
AATGCCATTCGCGACGGTCCCGATTCAGCTTGGAACTCGAAGTTGCGCCCGAGATATCCACGCAGAAGCCGCTGCTCCTTGGTCAACAACTTGACGGAAT
CGTCTACGATCGCCTTCGCAGCCAGGGTATCGGAACCTTCACCGTTAGCCTGCTGCGCCAACAGATGCTCGTACGCGACTTGGACGCGGAAGGCGCACTT
GGACAGACGCAGAGCGGCCACGTATGCCGACGACCCCTTCAGCGAATGAGCTTCACGGCGAGCAGTGGTAAAATCATTCCGCTCGTGAGATTCGACGACC
CGTGACGTAATAGCCTCCGCCGTACTCGCAAACTTCTTCAAAAGGGACAAAAAGAGCTCCTCCTGGCCACCACACTGCTCCACTCCCAGCGCGTAATTCA
CAGGGTCCCCTTCTGGGATCTCAATGCTCATCGGGTCGATGGAATGCATACCTGCAGACTCGCCCTGGGTTGTAAGGGGCGATGTGTCATCGTCCACTGA
GCTGCCCGTTTCCATGCGCTCTAACACAGAAGGCATGCCACTGCCACTGCTGCTGCTGTGCCCACCTCTGCTCGGATGCGAAGATTCATAGCCGAGTTCC
TCGTGGAAGCTGACCTTCTTCTTGGGGACCAAACCATACCAGGCCTGCGGTTGGTCTGCCGGTAGATCCTTCTTGTTGAACGGCGGGTGACTCCAAAGGG
TTGGGTTTGCCGGCAATGAAGAGCGC