Description :
From Genome Similarity Track
Location :
Scaffold_366:8139- 9920
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_366-snap-gene-0.6CDK-activating kinase assembly factor MAT1
Pytap_DAOMBR444maker-pag1_scaffold_366-snap-gene-0.7Conserved gene of unknown function

Sequence
1781 bases(100 bases per row)
CGACGATGACAGCAACGTGCTCAACACAAAGATGAAGATGTTGATCTCCAAGTGTGGGCATCGCTTGTGAGTGAAAAGCGTAGGGGGGAGGCACGGAGGG
AAGGACTGACGGgTCGGATTCGATAGTTGTGACCACTGCATCCGCCGCGAGTTCCAGCACCAGCGTGAGATCCCCTGTCCAGCATGCCAAAAGCCTGTGA
AGAAGTCGCAGCTACAGGATAAGACGATTGAGGAGCTGAACTGCGCCAAGGAGACGTCTGTGCGGAAGAAAGTCTGCAAGGAGTAAGTGAAATGGGGGAG
AATACGGTCCGTGCgAaTAGCTGAACTTGTACGACAGCTATAACAAGACAGAGGATGACTTCAGCACGTTGGACGAGTATAACGACTACCTGGAGATGGT
CGAGAATCTTAGTAGGTGATACAGCATGAGGTTGTGAGGtACATGGAGCGGGAAAACTGACAAGAGTGGCCTACAGTTTTTGAtctGGTGTATGGCGACG
ACGACCAGAAGGCAGTGGCGCACAAGCAGTGGAAGCAGTATCGCCAAGAGAATGCGATCAGCATTGCGACAAaTGACGCCAAAAAGGCAGACGAAGAGCG
CCGTATCGCGCAGCTCATTGGCGAGCAACAGCGCCTCGCAGATGAGAGACGTCAGCTACAACAAAAGGAAGACATGCAATTTGAAGCAGATCTACAACGC
CAGAAGGCACAGCTTATGGAAGTAGCACTTGGTGAGCGAGATGAGAAGGATGTGGCCAAGATGCGTGCAACCACGACAGCGATCCCGATTGACCAACCAG
TAACGGCGGAGATGGAGGCTGCTATGATGGGCTTTCAGCCAGGCGTCATCGGTGGACCTCAGCCTGTGCCCGTGCCTGGTGGTAAACGTGGCCCGACATT
CGGTGTCCAGGAGTCTAAGAAGcTACGTCGTGACCAAcAACGCGCGGGTGgTTATGATCCAGACATGCACTTCAAGCgcaaccgtacggaggcctggtcc
agtatcttcttcaaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACCCGCAACCcATGGACGT
GTGCTGAACCCTCTCTCAGGCTCGGTATCTATTCAGAACTTTATAAGAATCACAGCATCAACATGTGTGATCTctATCCCCcTCTCTCCTGTGGAAaGAA
CTCCGATGTCTAGGAGAAAAGTTCCGCCTtGTTGCTTtGATGCTCAATGCCATCATCCTATCACAGGAAaCACCGCCTTCCGCTTACATCAAGTACAACA
TATTTCTACGAGCCTTCTTGAGAAGTCTCCTCGACTCTCCTAGTGTGAGGCTTCCAATCACTGCAATCAAACaTGACAGCGTAGTTTTCtCACTCTGCAT
CTCGCAATCTCCTACGCAAGCACGCCAACAAGCTACACGAAGTCTTACTCCGCAATGAAGTTCCACTTTGTCGCTGCAACtaTCGCTGTCGCGTTTGTTA
GTTTcACCCAAGGTgCTGATGTTCAGCCTGATGTCTCTCTTCCGTCTCCCGAACAAGCGCTGGAAGCCGTCCGCACCATCC