Description :
From Genome Similarity Track
Location :
Scaffold_2:813871- 830966
Transcript NameFunction/comments
Phyca_LT153498000predicted protein
Phyca_LT15345029624-nitrophenylphosphatase, putative
Phyca_LT153413021NlpC/P60 family protein
Phyca_LT1534502964actin-related protein 2/3 complex subunit, putative
Phyca_LT1534502966SET domain-containing protein
Phyca_LT1534525145Hypothetical protein
Phyca_LT1534502970Hypothetical protein
Phyca_LT1534525147Hypothetical protein

Sequence
17095 bases(100 bases per row)
gatggtcaagacggtgggaagtggtcaactcgcggcggcgttcggtgttggtgtggcggctgcattggcggcgcagtacgtgtaccaaattgcattgaag
cgccgtagctctgtgcccaagaccgaagtggtgaaatcccgcgggacggacgctgctgcacaggagctgctggaagaacaactgtcccgcatctccgcct
tcttcggtcccgagggcttcaccaaagtcaaagatgcattcgtggtggtcgtaggactcggaggtgtgggatcgcatgctgcccatatgctggcacgctc
aggtgtcggtaagctgagacttgtggactttgacaacgtgacgctgtcgtcacttaaccgtcacgctgtggccacacgcgcggacgtggggctctccaag
gtcgcggccatgaggcgccacctgcacgaaattgtgccggactgtgaggtcgaggatatggctgtcatgttcgaggctgatagcgctgatgaactgctgg
agggaaacccgacatacgttttggactgcattgatgacgtcaagaccaagtgcgcgcttcttgaggctgtgacccgcaagggactcaaggtgatcacagc
cacaggagctggtgccaaggctgaccctactcggcttcagatcggatcgctcaaggacgctgtccgtacgtgactcgctgttcgaatgcgttgattaagt
gctgattgttttcttttcgtttcgtgctgtaggtgaccccctagcgactaagatcagatacttcttgaagaagaagggtgtctcgtcgtcggagattaca
acgatcttctcgagcgagaagagcgtgtgcaagttgttgcctctggatgctgaacaagcacagaacccggaggagtttggtaacgttgagaacttccgta
tccgtgtgattcccgtacttggaacgatgcccgcgcttttcggtcagtccatggctgcgtatgtgctgtgtgacttggctggtaagaagatcaatccaga
ggcggtggcacggctgtcccgcgaccaacgcaataagctgtaccagaagcttcagcagcgtgaacacgtgctcttccacgaaggccacaagatcgagctc
gagaaggacgagatcgagtttgtgtaccaagagatctggagaggacgtagttccgttggtggatcccgcaacggcggtcacgatcgtctgtacctggcac
gctggcggacggatcgaccgctgcaccctgacaacgtggtctatctgacgacaaaggagctcgccatcttggacaaaagcggcattgaaggcttcgaccc
tgacgttgttgctcgtattgatgctcgtctaagtcaattcggcagctggactattcctcagtaaaaacagttttgcagatttttggaggacaccaaaaac
aaatacttagatgaacattttgcagccaagtttcagtgacatgtgcaagaagcttgctttttgtatggtctcaaccgttatacaattctacagtacgctc
catgccacctcagtgacatccgattcagttagcaatccccctcaagaccagcaaccccctcatctaccatggccgccaccaagaaagtgacgcaacgact
tacccgcgagtcttttaagcagtggatccagggccttgatgcctttctcttcgactgtgatggaggtgcgcaaaagacttttgacaacttgatacggaat
gaaaatctgaatctggttgatacccgacagtgttgtggcgtggagctgcccctattgagggagctgccaatatgatcagcctcctgcgttcgctcaacaa
gcgcgtggtatttgtggtaagttgtatgaagattttaagagttgagagttagttgagtcttaacgtttcgagctgtgcagactaacaacgcgaccaacag
tagagccacttacgtgaagaagcttggtacgaatgacgtagatgggttaatgtagggtggtcttaactgattgggtggtgcaacagcttctcagggcatc
accgctgtcgaggctgacatcgtgacgtaaggcgtgtattactttaaacctgtttgataaacggtactaacgtgttgtgctttagttcggcatgggcaac
ggtgcagtacatgaaacagcacaagattgagggcaaggtgtacatggtgggcgaggcaggtctccagacggagctggagcttgaaggctaccaggtcagc
ggaatggaacacagcgacatcaagggcctcccacacgttcctgatattgacatggagacgaaggccgttgtctgtggtctggacaggtaagcaggttcga
acacttttctatccaggagcgataccattaacgcacctgttcgttttgacgcagatacttctcgtactacaagatggcgtacgctacggcttgtgtgcgt
cagatccctggctgccgcttcattggaactaacccgtaagtttgtactcgtgattcatgctggtcatcttttcattgacggtggttaatactttcgttca
gtgactcgacgttcccgactgatggcgccatcatccctggcggaggctcgctggttcacatgctggagtgcgctgttggccagtgcgtattagcttttgt
tctccagtattgttcagaatgcgcacgtactgagaattttgtggtatttggttctacgcagtccccccgaagccgtgtgcggtaagccgtcacaggatct
gcttcagacgatcattgccacgtacaacctggacccttcgcgcacgtgcatggtaaagatctgctattaccagtagttgcactgatcacaagctgatcgt
tgtttgctgtgctttgttaggtgggagaccgtctttcgactgacattgagttcggcaatggcggtggcttgagtacactgctggtgcttacgggaatcac
ggctgagtcggagctgagcagcatcgacaatgctcttcacgtgcctgaccactacgtcgactcggtcgatgtgatcaaccaacttcatgctgagacacta
gacaattgaactgttgactgcaccatgtctggttaagctgtctttgtaggacatgacgttattgcaaccgtgaccgaattcaatagagccgatgtgaaca
tgagcgattcattttttttcgtgtggcaaatcataccacggatagtatattacactttgaacatcacttcaaaagctaaactgacggcgatgcgtctcct
gaattcttcactttcaacctgggaatcgcccctccacttccactgttcacgaatgcgtcaaacatagagaacccgccaccgttggaagcagtactgccac
caccgccaaatctgttcgcattggttggtgttttctttggtcgaacaggggcggaattcagtcggcgggtagtaactgtgctgcgatcacctgtcggacg
aggtcctggcgacgctgccttcggcttgattccgaccatgggagacattagaggagttggagtccgcaggtatcgtggcatcggcgacttcgccaagcgc
ttcgtgatttccaaaaactgcaacttctttgcgggtgtcacatctgtagctgccgtccctcttggcctctttcgcgacggagcacgcaaattccctggag
gttcgtcatcgctgattaatccgctgctgtttaagctgatgtttaagtctccatcctccatcatttggtcgcgttgtgatacgtcaggttctgccgtatc
gcccttcctgaattctgcccgcttcgccgccaaaatatctgcatcttgagccttttttgatttcttgcccagcacctttggagtgctaatatcttgcatc
ttgctaatccgagcaagtagttcagcattcgccaaccgttgtttgatcgacatcggttcactcctgccactaaccttcttccttgttggcgcggcagtcg
atctctcctcgggttcagctgaagtcttcccgttttttgtctggggtttgcttttagctcgtggattcgtttttcccccagcagtactacttgttgactt
gtcgggtattgagctccctgctcccttcttcgctttgacttggattgaagtgttcgccatagttgccatcaaacttttccctcctaatgtagcagcatgg
cctgccttttgatcttttcgccgtttcaatcgtttctggggagtagatgtagatggcgctggctcaggctcagactctgtaccatcgctctcctcctgct
cagcagcgtccatctcagccttagcctgccgccttgcttccgcatttgtaaaattaaaatcaattgatgggccctttttcttcgcaaaccgcttccgcag
tgtcaacgttttcttcttcgacggcgatggctgacgtttcggagagtcttcagcgactggcagaattaaactcaccatagacggctcgtcatcgacatcc
gagtcactccccttatccagcgacaacaggttcagcagtccgtcatctggtagttcaggcggcggactgtcatatccaccaagttcatcctgattctcct
cggacactgagtcgtcctcaggctccaccggcggcaaattaacaggcgtaattctctttggaacagcagttttcgtcttttggttcttcttaatctgcat
cttggccttcaccaccgttggcttcactcttgagacctccttcctgttagtcatagactcctcgcccgttttggttccaatcttcttcacctttttctgt
ctcattgcttcctgtttcatatacagagcttccttcctttcttgttccctctcttcggcttccttcctttcttgttccctgtcttgagcttccttcttct
cttgttgacgccgcatagcctcctccttttgttgacgacgcatagccttctcatcttgttgacgacgcatagcctcctccttttgttgacgacgcataga
ctcctccttttgttgacgacgcaaagcttccctgtcttgagcttccttctcctcttgttgacgacgcatagcatcctccttctttcgttcctgcttctcc
agttcctggcgcttgagtctacgcagctgctgcttgtactgcatttcctccttctccattttttccattagaaggaattgctgccatgttttctgcagtc
gttggcaccgaaggtcaatggattcccactatacagttgataatcaccacaacagttcattagaatacatgcagctcgcgttgtgtccacgttcagcacg
tacttccaagttaaacgcctcgagtaagatctcctccgggtacggtccccccgtatggggcaaggttctctctggggactccatacagccctcaaatcga
caagccctttgggcacgtcgagggtagtcggatttcctttgcgcgctgggcgattcaaattctaaatgttcgttgacgtggtgcacattgttctgatgta
cgtcacactacggttgaagctgttcttgtacagagatctagagacatttgtcgcaatacaagaactgcaccataatcctttcccagaccaaaaggggagt
cagacttgatacaaacagcaagacaaaacactgcatgatggtagcagggggcgacgcgaatctcttccaactggcggacggcatctcgtgccacgcgtgg
aacaaggaccgctcgaagctggccatctgccccaactccaacgagatctggatctactctggctgccacgctgcggacccgaagcaatggcgcaaggaag
cggtgctaacggagcacgacatgctcgtgagcggcttggactggtctcccgtgcacgaccagcttgtgtcttgctcgcacgaccgcagcgcctttgtgtg
gaagtatgaggctgcctaccgccaatggaagccgttgcttgtggtacttcgaatcacacgtgccgctacgaacgtcaaatggagccctgatggtaagaac
ggagacgttggaattaaagggaattaattgctaattgaaaatattattgtgtgtaggtaagaagtttgcagtgagcagtggagccaagtgcgtgtcggtg
tgctactaccaggcagcggagaactggtgggtcagtaagatcatcaagaagcacaagtccacgtacgtagcttcaacttaaaactgttctggctagatat
tgagctgatcggtggatttcatgcagtgtgacggacttggactggcacccgaacagccagttgctggtaactggaagtacggacctaaagtgccgcgttt
tctcggcgcacatcaacgacgtcgacggatcgtcggatgctggtccgtttcaagccctacctccgtttggcgagcctcttgcagaattcgacaatgccag
tgcttgggtgaacgctgtcgcgtggtctcccaagggcgaccgtttggcgtttgccggccagggatcgtctattcacattgttcattttggggctcctggc
gaatatcctacggttcaggtaatgtcagttaatgtgggaacgctgtgctcttgagttgcttgtactgagaacattattgtgatgcagtcgatcagatttc
cacatttgcctctgatgcgcattatgttcctgtcaaattcttcgattgtcggtgtggggtacgacttcaaccctctgctgttctcccaggacgccaacaa
cttctggtaagaatcttgtgattgtggatgcacgtattcaagctgactgggtttatttgcttaggtcgttctctgagtttgttgacaagaaaccgactga
gagcgctgtgaagagaaacgcgggtggcttcagcgctggtacgatttttgcttcatcggtcgtgtaaaggttacggttaactgatttttttattgcatct
gatgaaccacagctcgtagcctgtttgaaagcaaggtgacgcgtggtcagtcttctgatgctactcagcacgacaagaatatgctgtggatgtacgttaa
atttgtgtcgtgcgggtatgctgtgctttgacaacgaatttgatttaatcgcaggaaacacgagagtaacatcacctgcatccagccctacgtgaagtcg
gcctctgggagcgtctcggaattctcgacgtcaggtacgctagaacgaaagtgacttgtgacggtatactgaagtgctgattctgtctgattgttttcac
tttagcactcgatggccgtgttgctgtgtggaagctggggagtttgaacgtggaactgagcaaacttcatctgtaaaaggataatctgcctctcgcattg
gcaacggtagataaagtctctacaatttacgtgtagactcaaaacgcacccctgttggtgctgtagcacaatgagcaagaacgccagctatttttctagc
agtcggtcaacttgggtatactctttggaattacaaccggggccacaattctattcgtacatctgctttagccgtctatactcctggcgatactggttct
cgactacagaagcttggcgaaagtctttccactctggaaactccgcgagcagcaccttcgggtcatacgaaagcagcaactggataccctggctaacgtc
attcagcgtacgcgcgagatcaatgtgctctgggttcaggtacatcctctggagctccagcagttcgtaactgctgcgcaagaaaaggattgagtactcg
cagacacgctcggttttcccacgcaacagtagatcacaggagtcagctaccagcttgtggatgcgcataaataccaagtggtcatgggccacaatctcaa
gcgcgtccgacagcgtctccaacgccacagagagcgcatcggcagcactttcggggttcgtcttgatgatctcctccgcaccaaccagcactttctccaa
gtcgggcatgtcaggtttcgttccatcgctgtcgttcgctgcactcggaggtggaggcagtacgctgtcgccacgcttgcaaagcgcacaactgcactcg
aagccaaactgctcccacagattcttctgtctgttctcatgactctgctcccgcgggtacaagtacgaaatcgtaagttgctcccccttggcgatcggtc
ttgccactcgcacctcggacacaccaccttccggtccagcatcctccggtgtaaacttgacgcagtttggattacattcgtggttgaacatcgcattata
caggaacacaccgctgtcgaaggcgttgcattgcatggcaaacacattctgcagcacttgatcgtgcgacagcgccagctcgctaaagttcttgcacagt
tcgtccacttgggggccgtatttctccctgcctgcactcagcaattggtcgggtagctcactgagcttctcagggtacaagtgcccaaggtgatccatta
tgtcagcgtagtccggtcgagacagcaccgattccatcgtggcaaggaagaattccggatctgacgtctctacgtcacgaggccaaggcacatatacctg
ttccactaagacttgagtacctggcttcaggtctctcgtagcaatatacccacgggatcctccaacaccattaaagctcgtcactagatctataggcccc
accaccagcggtttaacgtcttcccaaggctcgtacagacttttggttgcagaaatcgcgtctttctcctcctctgcatcaggtaattgcgtggaaacag
cggagatgatgtgcacaacctcgtgcggcgtcactagcgtctcttcatcgctgctgtcgtcgtcgaagaggccgaacgccgcttgcacagacgcactggg
cttgccactcatgctggttggcctgcaaattgacatcataaaaaaacaaaagacgatcgctgattagctaaatgtcattttgtcattatgcttaagtacg
attgtaagacgacttttcattggctaaagaaaaaaaatgagaattccctctctacacaaaccacgtcacaatcgaaaataccgacccctctcttttgtgg
ttcgtcatggcggaagacttgagtgcaattccagaacaagctgcactacagcagagtgatggtcttgcgagcgcgggaacgtccggccttcctcttgggc
gtcgtatgcggctgacgctcggccagaagcgcgaggtggtggatctggcagccagtaagaagttcacgcaccgagagctggccgagaagttccgcgtggg
acgcaccaccatcaccaatatatgcagacaggaggacctaattcgcacggaaacagactcagcagatgctattaagaagaagaggaagaccacgaggtgc
acgtacgatctgcgggtgcttgacgagtgtttgcacaagtggcggatggaggtgaaagtttccagtcctgataccaagctcacaggcactgtgttgcagc
ataaagccatgcaactggcctgcaaaatcgtgcaggagccctatgcggcgttgcctgataaagtgaagcaggcgttgcagaagtttacaggctccaatgg
ctggctggatggatacagaactaggttcggttcgttcagtagtaagcagatccctggtggaggagaccagagtgttatcaagagtgtggatgttcagacg
aggctgagagagctccattatgcctttagtaatgtggagctcgaggatatttggaccggaggggagtttgcagtcacgtacaaaccgccagtacccgatg
cagttaatggaactgagaacaacagatacacagtatcactgttcgtaagtgcggctggagagaaacatgacctgcaagttattggtacggacagaaaccc
actgctgctggagaaagttgacaccaaggagatgtacaatattcagtacggatactcgaagacgggctggcaagtggcacagacgaccgtgagcatgcta
aagtcactgaactcagtcgcgaaggaacgcaagcgcacgttccgagtggttttggactcagccgtgcctcacgttaaagctgctatgatcttggactcgc
agggagaccagcgcacgtttttcgtgtacgaccatatccagatttatttcctgccaccgaactttaaggtcccacgattccacccgtgccatcttggcat
tgtccaatcttttaaggcacgcttccgcagtgaaatgctcgagacgttgttcaacaattaccggcagagcgtgatgagccaagaccctcgtggtttccac
ccgcagcgccacttgcatactcgcaacgttttccactggttttgcgttgctcttcacagcctggacaaacaccttatccagacttgctgggtgcagagcg
ggttattacctacgcagtcaattgcatctctcaacttgcgagtcgttttaggcaacggcgcagcgacaagcgggggcgatagtagtggcgcgaattctga
tgtgggcggggccaatggttcaagtgagacaacaaactcatcgttggcagtcaatggaagttcactggccccagcgctactgtatcgggaactacagcaa
cagctaacaagtatcgctcaagttgctcctgacttcctacggtggattggagtagcggatcccacaaacgcccaggcatttgtagagctggaaggcaacg
cttccgtgaccgacccagggattgatgaggtccagattatccgtagtgtgcttcaaaagctcggatacttgtcaaccaaacgacttgacgacgaaagcca
ctcggcgggcgcatacgagacctttgaagacgtggctgaggagctgtgcccacgacccgaagaagttctcgcttcgatcggcattctcaagagatatctg
cgtttgtcacgagacccaatcccaagccgggttgacgctgttgtacagttgaacgaggtgaagaaagctgttgagaccgccggacttcgtaacgccgcaa
tttgagcggaagtcgcctgtcgttcgggtttatgattcatgtgttcttggattcaatggtagtagtatcatttatcttacacatagcttgtcacttggtc
taacagaaagcgtctttcttgcatcaagctagtaaacagtccggatttttagttggggggcatggctgacatcatgggagcatcgtcaagccgtcgattc
ggcgttggtaaaggtgatggcagccttgtggctcgggcagcggaaggcgacggacgtggcaacagatcgtcttctaagggcagaatagttcgttcagcga
tggcttgatgctcgatgcggcgttgacgccgtgcgtaggcgaccagagttcgaagggcactaaccagccagtcacgatggcttgagctctgggtctccag
atctaacgtacgtcctcggaacacaactgagaacgagcatgcatcgagcacacgggtaaacggatacttgcggaacactcccgtctgtcgtccatctagc
acctgaagcacttctgctaaatccacggcttcacttagaccccctcgtttgtgttgccactgcagtgttccgcagcaattgcagtgtagacgggttgcat
gagctcccccacggcggccatacttgagcagtgggaagaacatgttaatcgcttgcaccagatatgatcggtgcttgccgccgaagcggaaagccaactc
cacaattttccatcgagcgccttctatcgtctccagctcttcatctgtgaacaagtacgttttgcgcttcttgcgtagatgaagtgtctctaggacacga
ggaccgatcctcgagaacgcactcttcttgtgtttcttggccggatgcatttcctgtgggagaagtgtggggcttattggcggtggtgtaggcatagaag
gctcatccataggagacggaatgccaaggtcgtacgcactcgggcaagatccggccctccttcgggtaggaggaggcttggacttgagacgaatcccatg
ggattgagacagcggtttgttcatctgctctgagtcgtcctgcagctcaatcactagccgtcgtacactcgatgtaagctggtcctgcgcggataatgca
gcttgttcgtgagcacagctcaacaggcgagttcgatgtcgctgcattagcctgtgctcagcggggctcaactcttgcatcggaatcaaggcctcttctt
cttcgttgctgggtctttcctggtcgacgaaagtgtggtcgatgtccagatccagatcctctgcgtcgtcaacgctatcaacatcttcgtcgtattcctc
gtcctcgtcctcgtcattttgattcgatgtatctgcagcgttcaacacaggaacctttgcctcgtccaacaggctttcacttttgatccggctcaccaac
gtgcgcacactggcgggcatgttgacatggtcgaaatccaacaagtcttcgttgtcttcctcgcttttgtcatcggctgagacatctccgtcactacaat
gagcagcacgacgctcttcctcctcgaggttctccagttcgttgttgtccatcacttcatcagtcggttccacttctggcttctcttcaaggacgtccgg
taacatcgtgggtggcgcaaagctcgtgtgcatctcgccgaactcccccatcatcgcctcgagcgtagccctccgcatcagttccgcgtgactcaatggt
tttgccaaggctgccgccaccagcggccgagccggataaaactggagccgtttgtttgcacctcggccgttggagctctcactagggtcccacatggtca
tattagactgcattgttggtgtcgcgccgacgctactgcgccgtaaatgtcgatttttagccgacggtggcttttcctcgtcgctctctttgtccaagtt
gctgctgctgttgctgctgatgctgctgcgactactattgctgctgttactaccttggacgtcctccggatccacctggaatatactgccgcgccgcaca
atagccgacagcttgcccagcagcactacgctagacgagcgctcgcggcctggacgaccgcctgaccacggctgcatgtggccgtacagaacaggaatgg
gaaaatccacgcggacgagagtgggagggatctctccggacttgtggcccaatgcgaaatgagtgcgaactcgacccgaggaatgagaaaaccgtcggac
acttgcaagtggccggacacgacttccgcttctggacgcgatgaccagagtggttgtggccgctgactaccgtgggcttctctgcttttacaaataaccg
gcactgggccgttaggtcaaagtgtcttcaatgtgaccaatgtagccatgctgtattccacgggatatcgggtttgaaaagttgaaatctgcaactaatg
cggctgttttcttcatgcacggagtcagacgatatagagtttgccaggtattgacgacaagtgtccgagagccgttatcggttgccatcgggccgctgct
ggaacgttcagcgttcagatgctcaagtcggaggtcatcaccagccaccaggcctgattccacgggctccgatgctttccatctccttcttcgtcatttg
tcgcctggccttttgccgcacctcaatggaacgagcaacagcggatggccacaaccacatctttcacccggacatactgcatgatgctgcggggtttgct
ggactccccaagccgcaccacttggagaacttgctacaacttgcctcaagccactgaaatgacgcacgaatggtacactgttccattacctaagcgtgtt
tttaaacccatataaaaccgtttaagagattggtttccaattatggtgagtggtggcaaagctgctcgacgcaatgctgcgcagcgtcgcgcccggctgc
aaggcaccagtgcgctgttgcagaacagtccggatacgacacacccttcctctcgtcttcttgtgtggcattcgcgcttctctcacgcagcgtcacgcca
tgaaagcatcattaacggacactgtttcaaccagcagttagaggtttatctcccgtcgaaggctggacaggctacagcacaatcgttacaatgggaaaca
ggcttttattacgaggtgaaggcatccgtcgacatgttcctgtcacctacatttatccgagagtatctgacagatggcggcacagtctttatggtggcca
agaatgctgcagtggacgcgtcgcagtcggcgatgctgctgccttcgggtcagttgctattactggtggatgcagacacgtaccaacagttagggattgt
tggggagaaatatggcaaggcggtggctgctacaagcaggtcggcacattcaaagcgtgctcagaagtacgtgatcacactagacctgacgtcgcccgct
ttcactgaaggagaaaattcctttagagatcgggttagacaatgcttaagtactaagcttgaagacctagagatgctgctgtgcgcgtacaacgagcggg
gctcggcacgcacgatcctgtttggagatgacgaccagattccgcgttcccgcgttgagctgaatgccaagatgacgatgttcacagacgtgtttctgcc
caagtttgacgtgttctacaagcagctaggtatgaccaaagaacatggtgatgaagaaggagatatacttcgaacgtcgctgcaagaaacgtacgattgg
ttgggaatggtgtcttgtggcctagtcgacttgctgcagagaaagaagcaggaagagtatgtgtcgacgttcacggggattccggactcgttcgagagtg
aaccgaacagtgagatcacgactgtgcgatggcgtggtctaattgcttctcccttttgctcgacgattgttagcaaggtgcagcgtgctgttaagagcgg
ggagattccgtgggcggcagtgacggtctggggcttcccggacgtcttcgtatcgtgggtgcaacccaaggcaagcaaaagcaggaacggaacaagtgag
ttgcacagacgagaacatggatacgtgggtaatggcaacaacaactacactcttctcattttcccggacgacgagtatttcctattgcaagcacttggtc
cgcacgatgccaccgtctagacgtaacgaacacaatatagcatcaatatccaaagtactgctatcgatggtaatctttttgagccatgagagtgtctagt
tcaccaggatgttctcgacgaatgctgcaaccgttgaggagtttgagtcagacgtagcttcagccagcgtaacagcaaccttgatgtgcttccgggctgg
tttcacgttattcttctttccatgaatgagtgccagccgcaggtttgccaagaagcaggcagcaacatcgctgtaagtactcaaggcggtagtagcactg
ctcatatcgtcatcgccttctgtggagccaacggacttgaccgcagttagcgaagcaacaagcttccacacagtgatagcagcatccaacagctgaagtt
cctcatagatgccaccaagctcaattagaatcggaacaagtcgactcgaaggcacagcagcacccgatacagcagaaatgataccaagatacttttcgat
ggcctttgctgggtttgacaccatgagcaatcgagcttcaagcagatcagtgttcactgaaggcttaagagtgccatttttcctgcctgcttccacttgg
ctcagtgcctggccagagatgacaactgcctgatccacttcacccagcttaatgtagcagtagctgcttagtaattccaactgaactgcgtcgtactcct
ttccagcagcaacagccagtcctaatccggtctgcaataagcgaattagttggcgaagagtatcatgctgtgtctcttgcaaggcttcaaaattcatccg
cttgagaacacttgctccagtcagaacgtacgaccgcgggttccaaggttcagcacgaaccaacttttgcgcagtcaagcacagcccctttaccccggcc
aaatcagtcttaaataaccccagcagcgcatcgaggagattgcgatccgttgtctcatttccaggcgacggtatttccctggcagccgaacgcatgtact
ccataaggcaattggacacctggaggttttgcgaatcaattgttgcgagagctaaccgcatccataacatacttgagttagcgccatcagaagcttgtga
cagcgcttgtaagcgtggcaaataggcattatcatcgcccacccagcgctcatgtagttcgaccaaccgtagattgagataatcgcgggtaacgaaagct
gaccccgcttgatcaattgcagccaacagtcgatccttacacatagcagcaacacctgctgccttcgaggtgaattcattcatcaacaggcttgccaacg
aaaggccaacgagagcaacggcatcggtttgagtagactgggaatcgtcttgcgccagaaaagcctgaagtaaatccaacgcctcgcctccttttgactc
gcgatacaaaatctgcgcttttacgatcgttttgactgctgttgatttacctgtcaaagggtcaatcagggcgacaagttttcccaaaagtgctgcctca
tccgccttaacatcttgggacgtagtgaacaacgcaccgagttttgtcaccagagtgttccattcaaggtcctcaggctgaagcgctgacgaacccgctc
gggcgtaagacgccaaagcctcggtatagagtccaagacgatgttgagcgacaccgagagcatgccacgcacgaccattaaaaggatcccgttccagata
ctttttgaggtaaaacattgcctgctcattgccgtgctctggggagttaatgatcgattcgtcgacgctcgcaccaaaatcaagtaatgccatgctcaaa
cccaataaagcatccaaatccagccctgtctgtaatgcacagtcaaacgcttcaatcgcttttctttgctgaactgtcgagtttgcttgacggcgagcca
gcattccataaccattccacatgctcgggttactcgggttcatgctctgcagttgaagaaacgacttctgtgccaaggcggccgtcgatgatacagcatc
agcctgagtcagatagaacatgcccatattggcccacgtagcgtcgctgcttgtgccagtttgaactgctcgtgcccaggcaaactgttttaccagtaaa
ttttcagacaccagtgctaagccattccaagccatcgaacatgccggatccttttgaagagccaacttgaaatttgtcgacgcgttcgccttcag