Description :
From Genome Similarity Track
Location :
Scaffold_154:8138- 17398
Transcript NameFunction/comments
Phymu_g5645hypothetical protein
Phymu_g5646hypothetical protein PHYSODRAFT_552333

Sequence
9260 bases(100 bases per row)
TGACATGGTGAACAAACGCACCAAGAACAGGCGACGAGCCTCCATGACGGTGCGGAATCTACAAAGTTCTACCAACCGACCGGAACGACGTCATAGTGAA
GCCACAACGTCCACCAAAACAAGCGAGTTAAGCTATGCAGAGCCTGTAATCGAGAACGCAGAGCTCTTGCCACCCCGTCAAAGATTGGAGAAAGATGTCG
ATGTTacagcactggaagaaggcagctttaaggacggcaagaagaagttcgccATGATGTCTCCTCGTCTCGATGCACAGTTAGGTGGATACCCACCGGA
TTGTGGCACGAAAGAGCTGAAGTATCTCTCCTATGCTAAAGTCCTGCGTGACCGGGGGATGACGCATCCAATGCGTTACTCCAGCACTCGAGTGGATGCA
CGCGGTTTTGCCATGCCAGAGCGCTACCCTTTGTTTTCCACGGACTTTGGAGCACATTCGTTCCACCACTTGCCGACAGATTCGACTGTGTTGAGTCAAT
ATGGTCTGGGAATCGCTCTTTACTTCAAGTATCTCAAGGTTATTACGTGGCTTTTCCTCCTGCTTGTGGTGATCAGTGCTCCTACATTGGCGGTTTATAT
AGTCGGTGGTGGCACTTCCATGGCACAACTCACTGCTCTAGCGCGGCAAGGACTCCCTTCTGTCCTGGGTATAACCAGTATTGGCCACCTTAGTGAGGCC
AGTAGTGTGTGTGATCAAGCTATTGAAAACGCAGAGCTGTCGCTCACGTGCTCGGCAGGTGAGATTGGATTTGTGAAGGCGGTGTATTCAACCTACGACT
CCCAGGGAAGCTGCTCATGTCCGGAACGTAACAAAGTTGCAGAAGGTTCTGGCCAATGCCGTGGTGATGTCGAAGGATCTGATTGTCCCTTGGATGGAGC
AGGGTGTTTTCTTGGTGTTCATCCGGTCTCGCTTCAGCCTTGTTGTTCCTTTTCGCGAGATGAAATCACGAAGATTCCAACGTTTGATGACATGCGTGTT
CAAGAAAGGGAAGGATGCGGCTCTGATAACGCTCAAGTAATTGTCGAAGGACTGTGTCTGGGCAAGAAAAGCTGCACGTTCAATGTTAGCGAGGCGATCA
CGTATGTATGGGAGCCGGACGTCCAGTACGGCACGAATTGCTCAAAAGCTCCGACTATTGTCACAGTTGACAGTGTTACCAACGTCACAAAGGAGGTTTG
TGAGGTTGGACTCAATGAAGATAGTGACTATTCCAAGTGTGAACCTGACAAGCCCCGAGCGTTGATTGTGTACGGGAggtgcttcaccacacgTATCGAT
TTGTCGAGTGCGTGGAACCTCAAAATTATCGGCTGGGACTCCATGAGCGTAAGGTTTTGTAgtttttattttatttttttagCTGGTCTAAGCCAACTGT
TTTGTGATGTAGCGACGCGAATTCTTGGGACTCGCAGTAGGGTGCGATATCGTCTGCAGTCTCGCGTTTTTTGGGGTTGTTGTATGGCTCCGACGCAAGG
AAAAGGAAGCTGTAAACCACATCACGCAGAATCAAGTCAAGGCTCTCGACTACACGGTGCAGCTAGTACACTTACCGCACCATGACGACCTCAATTTGCT
TCGGCAGGAGGTGGGTGAGCTATCCTAAAAATGTTTGTTTTCgttcttttttttttgctaACTCATTTTTCTTAGATTCGTCTACACTTAGAAGCTGTGT
TGAGTAATGCCCCACCATTCGCAGTAGAGCTCGATCGTATTCGCGTTGCCGACATTCAATTCGGCAAGAGTGCGTCACGCCACTTACGCTTACTCAGTCG
CCGTGGTGTAGTCGTGCGCCACCTTGAAATCGCCCAACAGCGTCATGAAAAGTTGCAGCTATTACACGGACGGTTAGATGAGCAGGTGTACGCTAGACGC
GAGAAGCGTCATCTACGTGCTATCCACAAATTGGAGGTAAAACTGCATCGCTTTAACGTTaagctggagcagtggcgGATCCGATACAAGAGATACAATA
TTTCGCAAGCTGTGACTGCTTTCGTGACattcgaggaagaggaaggtCTCCACCGCTGTCTGCAGGAATATCCTGATCTGGGTTGGTTCCACCGTCTCTT
TCAGCCCCACTACAAGCGCCTCCATGGCAAAAGACTTCGATTCCGTCCGGCTCCGGACCCAACCGATATCATTTGGGAAAACCTGCACCACCCGTTCATT
GAGAGGGTGTGTCGACAACTGGTACGTTGACATCTGCGCTGTTCATTTTAATTCTCAATTTCCTAAGTGTGAATATTATGCAGATTGTGGCGTTAATCAC
GCTAGCTGTGCTGTTCCTGAGTTTCGTATTGATTTTCCTGGCGAAGGAGCAGAAAAGTAAGCTGGAAAGGCAGTTTGGGCGACCAACCAGTTGCCCAACT
CAAGTTCTCAAGGCTGATGTCGTCCAAGATGAGCTCAACAAGGCTTCGCAACTTGTACCGTACAAAGCTCTTATCGAATGCTACTGCAAGAACTTCCTCG
TTGATCAGTACGTTCACCTCAGTTTTGTAAATTTCATTTTTAGGGTACGAAATCTAACCTAAAAACTTCTTTTACAGCTCTTTCCGAAGTATGATGTACG
AAAGCTTCAACAACCCGGAAAGAGGAGAGAGCGACTTGCTGTGCCGGTCTTGGGCTACAACTTTCGTGACAACTCAAATCCTGTCCATTGCTTCGGTTCT
ACTGGTTGTGGCTGTGAATTTGATTCTCGCTCGTATTCTCAATGGGCTTGTGGCCTTGGAAAAGCACCATACCGAGTCCAGTTTGGTCGTGTCTCGTGTT
ACGAAAGTTTTCCTCGCTCAATTTTGcaacacggcgctgctgaTGTTGGTTATTAACGCTAACGCAAACTATTTCTCATCTTCAACTACTGTACCGGAGA
CTGGAACGTCCAACGAAGGCTTTTCACTAGGAGCGTTGCAGATCCTGGACGGCGAGTACTCGGACTTTTCGGCGGACTGGTACAACGACGTTGGGGTGGC
ACTCATGCTCACTATGATCATCAACTCGTTCAGTACCCACGCCTATGTATTGGCAAACTACGTCATGCTTAAGGCTCGCCGTTTTATCGACCGAGGGTAT
TCTTTCGACCACTCTTTGACAAAGCAAGACACTCAGCGAGACCTCGAGGCGCTCTACCGTGGACCAAAATTCGATCTCGCTGCACGTTACGCTCAATCTC
TCACCTCAATTTTCATCACGTACATGGTAAGTGGTCATTCATTATAAGCGTAAAACACGCTTCTTGCTAATAATTGTGCACGTAGTTCTCGGCAGGCATG
CCACTGCTTCACTTTATCGGCTTTGGGGCGATGATCATGACGTATTGGGCCGACAAGTTCAGTAAGTGATCAGTGTTTTTTTATCTTTTTGAAGTCTCTC
GACTAACCTGGAAATTGAACAGCATTTCTTCGGATTGCTCGATCTCCGCCTCTTTATGATAGCAAATTGGCTACAGCAGCAGGGGCTTTACTTCCGTATG
CGGTGTTGATGCACTGCCTCATTGCCATGTGGATGTTCTCGAACGACCGCATCTTCGAGTCGGAAAACGACAAAGAGTTTGAGCAGGCCACGATGAACAA
CACGTACAGTCCTGGCGACGGGATCCCTCTGTTTGACGGAACTCGTCGCGGGCAGTTGATTTCACGTGTCACGCGTCCTCAAGTTGTGAttctcttcgct
ttcttcgttGCTGGCTGTGCCATTGTGGTCATCCGGGCTGTGCTCTTCGAGTACGTGCCAGCTCTGGTCCGAAGTATTTTCCCGGCCCTCGCTCGTTTAC
TGGAAAAACCACGTGTGCCGAAAGGGATCCCCAACTACTTCGACGGTGAGTTTAACGACGCAGTTCTCAATGGTGCCGCGAGTGTTTAACTTTTGTCGTG
TTGCAGCCATTCCAACCGTTTGTCTACAGGAAAAAGTCGCAACAGGAGGTACCCAACTTCTGCGACCAGATCTGCGCGCCAAGTACGAGCGTGCTCTGCT
CCGACGTCTCGCACAGGAAGAAACCATGCCAAaaaagagctccaagcactCACAATTCACAGACCGCTACAACCAGGCAAATTGGATCGTCGGCTGTCAT
TCCTATGGTAGGTCAGTCTCCAATAACTCCTTGTTGGCCACAAGCTAACTTTTTTTGCACAGCCATCAGCGACAACAAGGAATACGTCGCCAAACTCGCC
ATCGACTCGCATCTCTCCGAAGAAATTCCCCTCGATCAGATATTCTAAACGGGTGGACTGGTATGATACACGCTCGACGTTTATTACCTGTATGTAAGAA
AGCCGCATTTTCTTGAAATTTTTGAGCGGTTGATAGTCTAGTACAGGGTCTTCGGGGACGGCGTAGAACCGTCAgcggtggacgacgacggcgtttGCAC
ACGCAAGCCAATGTCCGAGAGGTCTGACCTCTGCCCTGCACGGGTCTGTGGTCGCGTACTGGTATTACTGCTGCGATAAATACCcagcgccatctccgtc
TCGCCCGGGCAGTGAGAGAAAGCAAAACCAGTGTTGCGACGTACAAGGCGCGGCGAGTCCATGAccacagcggcgtcttcgccCTTCGCCAGACGATTCC
ACTCACGCATTAAATGCGACGGTTCTGGGTAGAACAGCACGCGTCCAGCCTTGGCGATGTAATTGGGCAAAATGGCAACGATCACAGACAGCAACAGGCC
GAGCCAGAACCAGGCTTCACGCACAAGCTGACTGACTACTCCAAAGCCCACTTCTGTGTCGTAAAAATCGGCATTGGTCCATCCGAATACGGCACAGAAG
AACGCTGTAAACAGGTAGTAGAACACCAGTGTACCGACAGTAGAAACGACGTTGGTCCGCGTCCAGTTACTCGTCATGAGCGACACTTGCACCGTTGAAG
CGGTGATCAGGTACGTGTACGATGCCACACCGTTTGCCCAAAGGCCCAAGTCGCGCTTATCGAACTGCAGTGTGGACGAACCACTCGAGAAGTACCACAC
GATAGAACCATTCGAGAAGAATGGGACTGCGTATACCACGTAGGCATGCCACGCACCCAGCACACACCAgccgaagaaggagagcCAGTTGAAAGACCGG
TTCTTCAAGCCGTTCACGTACAGTGTTGGGTACTGCATCAGCACTGCCGGAGACACGTCTTGGTTGTACATGGCAATCACCACGATGGGAATCGTCGTGA
AAAGCGCATTGTaaagagtgaagaagatgctgaagtACATGAGCAAACCACTGTacatcgtctccatcgccaagaagaagttggacATTGACAATGCCAC
GTTCTTCATGAACGAGAACAGGATGAGCTTGGAAATCCGCTTGTAACTGTAATTGCCGTGCACCAATAACAGACGTTTCAAGTACTGGAACTCTGCGATG
GAGTAGTCGCTAGAGAGAACAGCCTGACGACCTTCTTTGCCGCTAATGCCGACACCAACGTTAGCTGCCTGAATCATAGGCACATCGTTGGCGCCATCGC
CAATGGCTAGCGTAATGTTGCCTGGTGAAAACATGAGCGTGGGTTCCGTAACTAGCTTGACCACTGACGCCTTCTGGGATGGGGAACAGCGACAGCAAAT
GACCGATTTACATTGCGTAGccacggccaagaagaggtACTTGATATCGTCATCCAGCACTAGCGCGAGCGTTTTGCCGTCGATCACCATGGCaaactcc
agctcctcgtccacatAATCGCCACTGCTCATACTTTCCGTGCCACCCCTCATATTGTCAGTCTTCGGCTCGAAATCATGGTCACATAAATCTcggtcga
agctgttctCAGTAATGTCACGGTTTGGTTGGGCGGGATACACCTCATCATAGTGGGCAGGACTATCAGTCGGCGTCTCAGCCCCAGCATGTTCTCGTCT
TGGCAAGCGTCGCCGCTTTTtgcgcgcttctgcttcttcgtctcgtcCAACCAGCGCAAGTTTCACAAGATCCCATAGGTACAAAATGGCTCGCTTCAGA
GCTTCCCACAACACACTgactgctgaagacgttTCGTCCGACCCCCACTTGTCCTCTACAAGGTCGACATACAACTCCTCCAGTCTTGTTCGCAGAGATC
CCTTGTCGCGTTGGCCTAAGACAATCACATCCATATTATCATCGATCACATGCGATGACATGCCGATGCTGAGCGCGGTTTCCTTCTTGTCACCAGTGAG
CACCCAGAACTTAATGCCAGCCTTGCGTAGAGCACAGATGGATTCTTCCACACCGTCTTGCAGTCGGTCTTCGATGGCTGTCGCACCGAGCAAAGTCAAC
TCGACCTCAATAATAGCCGAAACCTTGGCGATTTTGGCGGCTCGCCCCTCCATGGAAAACTCTGCCTGTCGGTACAGTTGGTTCCACTGGTCATATTCCT
CCTGAGTAAGGCGCCGCATAGCAGTCGTCAAAGTTCGAAGACCTTCTGACGCGTATTCTTGGAGATGACCACGAGTCACGTGAGATACACCTTGAGGTTG
GGACTTCGACAGCAAGTCAAAAATGATGTCATCAGCCCCCTTGCAGTAGAGCACGATACTTCCGTCAGGGAATCGCACAATAACCGACATACGCTTCCTG
TCGCTGTTAAACTCCAGTACATTCAGGATCTCAAACGACATGGGTCTTCCCTGGATGATCGTGTTGCACATTGGTCCATCACGGGACTCAAGCACGTAGC
CTAGGTCAGCAGCTGCCAGCACAAGAGCCTCCTCGTCAGGGGAAGACGCGTTGTACTTGATCGTCGTGGTCGGAGCTGAACAggagtcgctgctggatgt
cgGCGACGTTGGAACGTTGTTCTCCGGAATCACCGTGTTGCAAATCGTAAGTAGCAGCAAGAAGTCGTGAATCTCTTTCTTCGTCGAGTGATTCGAATTC
AATCGCGCCAGCAATCGTCCATCGTTAAACCGTGTGCCTGGTCGTCCGGGTTTTGCAGGGTCTACCTCGATGTCGTTGTACCTGAGACCCCCAATGGTGC
ACTTTGCAAAGATCATCTCATTGCACGTGAGCGTACCTGTCTTGTCCGAGAAAATGTACTGAATCTGCCCGAGATCTTCGTTGATATTGCTGTTGCGAAC
CTGTGCCGGTGTGTCTGTCTTCGAGTCGTACATTTCCAGATCGTTTTCGATATATCGCGCGTGAACAAACCGAACGCCTTCCATCGTCACGTACATCGAG
AGTGGGATGAGGTTGTTGAACAAGATCACGTAACTCAAGAAAATGTAGCCGTTCGAGTCTTCCTTGATGTACCAGGGCGTCGTCTCATCCGCCAGATCCA
AGTTCCAGTTGTTGTTTCCTAGCGTGCAGGCGATCGAAATTCCGAAAAGCAGCATCAAAACCAGCACGAACATGGTGTCCAAGGTCTTCTCCACAAAGCT
ACGCTTCAACGGCACGGCAACAGAGTTCATTTGGACCTTCGTTTGCTTGCCTGTGTAGATCACAAGCCCAAGCGTCCACTCGGCGTTGCGACTTTCACTT
CCACGCAGAATCAAATTATCCATCGTCAAACTGGTCTCGTTGTCTTCCTTGTCAGCATCCGTGACAGCATCGTCCGTCATTTTTCCCAGTCTTAAAACAC
CGTCGAAGTAGAAGAGGTCCTTGTTAGGCACGTCACACTCCACTTCGAGCTTATGTCGGTCCAATATTTCCTCAGCCGTCAAGAAAtgcttcgtgcagct
cgctACCTGTCGGATCTTGAGGTTCGTTTCGCCATCAAGGTTCGCCGTCTCCACGTAGCACCTTCCATCCGGTCTGCTAGTGGCCAGTAGAACACAATCT
GCAGGAACCTGATCGCCGTCCTTTAGTAGCAGCACATCTCCCACTTCAATATCCTGCCATGTGCCATCGATGTGCATCACTTCGTCCAATACATCGCGAC
GAACAATGTGCGCCGCCCTGGAATTCACCAAAGCGTCTCCCTTCTGTCGGCGAAGATCCTCACTCACATCCTTCAGCGCCGAGGTCGCGAACACGAtcag
cagcggcgtcagACTGGCCACGGGACTTACAGgcgagaagtcgaagaaaCAGAGCGCCACCACAATGGTCGTGTAGAAATTCGCCAGTCGGCTGAACTGC
ATCTTGAGGAACACGAACAGGAAGTTGTAGTACGTGTACTTGCTCGTGATGATGAGGTTGGAGCAGAACACGGGCGCCTCTTCCTGTGCTTCCGCCTCTT
TCCTCCGCTggttcttggtcttcatcgcatccggcagcgacagcgacacgCCTGACTGAGTGCGTCGTAACCTGTTGTTCGGGACGCCGGGACCCACCAC
AATCTTCCGACGAGCCGAAGGTCCTACGTCCTCATCCATCTCGGCCGACGGGTTAATGGACAGCGTCTGGTGGAGCGAGTTGACCCGCTGCGGAGACGGC
ATCATCGTGGCTAAAGCAGCTCGGTCACACTCTCTCTGGTTCTGCACAGCCTTGACGATGCGGCGAAGCTTCCAGCCGTACATGAAGCCCGTGATATTGA
GCATCGTCAGcaggatggagaagaaaccCTGCATGAGCACGGAAGTACCACTACTGACACTGTTGAGCTTGCCATTGTAGCCCTTGTAGTACCAGATGAC
GTCCACGAGCAGTGTAAGCTGCATGCCGATCTTGTAACTGAGCAGAAACTTGGGCACGAGGAACTTGGTGCCGTGCCAGCCCAGTACCAGCGTGATATAC
AGGATAAGCACCGGCACCGTGGCTTGGAAGCTCAACCCCAGGATAATAGGGAAGATACGTAGCGAGTTGATGATGGTTTGGGACACAATCGTGAACTTGA
GGCGGCGTCGGGTCTGGTAGATGGTCATGCCCTTGAGGAAGCAGAAAACCTTCTCAAAGAGATTCCACAGCTTGGTCTCTGCATTGGGTTTTGTATCGGA
CGCCACCGAGTCCGCCATGCTGTCGGCTCGATACCGCAGTGAGATGATGttgcgctgctcctcctcaTTGGGGGCGCCTGTGAACGTGTTGACGCGCCGT
AAGTTCTTGTGCGCCAGAGGCTGCGACGTCGGCGCCTGCGTGGCGGAGGACGGAGGCGCCGCGCTGTCTGTGGACGCCTGCATGTCCAGCGTGTACTCTG
TAGCGCTGTCGGACGGAGAGGGCACCGCGAACTCGACGCGCATCTCGTCCGTGGGGCGTTGGCTTATGCGGGGGGAAGGAAATACACACGCGCAGCGCCA
CCCCGTCGGCCTATTCTAAGGTGTTGGAATGAGAGATTCCGCGCTGGCttgagaagaaga