Description :
From Genome Similarity Track
Location :
contig_8:813786- 815261
Transcript NameFunction/comments
g1695.t1phosphoethanolamine N-methyltransferase, putative

Sequence
1475 bases(100 bases per row)
CTCGGCTGACAACAACGACCACTCTGTCGCCACCTTCCAGAAGTTCCTCGACGAACAGCAGTACTCCAGCCAGAGTATCACACGCTACGAGAAGATCTTT
GGACAGGGATACGTGAGCACCGGAGGACAGACCACCACGACCGAGTTTGTCGAGAAACTCAACCTCAAGCCGGTGAGCGCGTGCTCGACGTGGGCTGCGG
CATCGGTGGCGGCGATTTCTACATGGCTCGACAGTTCGGTGTCTCCGTCGTCGGCATCGACCTCTCCACCAACATGGTGCACCGCGCGCTTGAGACGTCG
ATGCAAGACGCGAGCGCAGATGTCGAGTTCGAGATCTGCGATGCCACTGAGAAGGAATTCCCGGACGCCTCCTTCGACGTCGTCTACTCTCGCGACACGA
TCCTGCACATCGAGGAAAGCAGGCGCTGTTCGCCAAGTTTCCGCTGGCTCAAGCCTGGCGGTCGCGTCTTGATCTCCGACTACTGCCAGGGCGAGCAGGA
TCCCACCGACCGCTTCAAGGCGTACGTGGCAGGCCGCGGTTACCACCTGCTGTCTCCGTCGCAGTACGGCAAGGTGTTGGAGTCCGTGGGTTTCACGTCT
GTCGTGGCGGAGGACCGCACGCAGCACTTCGTGGAGGTGTTGAAGGAGGAACTGGGTCGTACGTTGGCACACAAGGATGAATTCGTGTCGGAGACGAGCG
AGTCGGATTTCAAGTACATCGTGGACGGCTGGGAGGCGAAGATTGTTCGTTGCGGCGAGGGAGACCAGAAGTGGGGCCTGTTCTACGGCAAGAAGGCATA
GTTTCAGGCTTTGATCCTGCTAGGATCGTAGATAGTTTCGCCCAGCACGAAGCCTTTCAATCGAAACTACTCTTTTATTCAAAGTTGACCAACTCCGTAA
GGCTTCAGCTGGGTCGTACCGTATCATCGTCAATCTTACTGTGTGCGGTCTTCTTTAGACGATACTCCGGTATTGACGGCATCGTGGTCGAGTTGCAAAG
CTTGACACGACGACCAGAGCTACATGACGTCACTTGCACTGCTGCGGGCCTCTTCTCGTACGCAGAAGTGCTGCGAGCCAATCCAGCGCGGCCAACGCAT
GTAAATGAAGGCACTCTGCGTGAAGAAAGGGATTTCCGCCGCCAAGCTCGAAGGTGACGCAGAAGACTCGGTTTTCCATTCCGAGGCCAGTCCAACGACA
GCCACACGCAAAGTGATCCACGGCGGTAATTGCCGGTGCGATGGCTCGCCTCTGCAATCGAATCTTGTAATTCCGCAGCAAGCCTCAACAATGCGCTGAA
GTTGCCGGACGAAATTCAAGGGTGATGGACGGTACATCGAACACGCAGTTGCCACATCGAGGTGGGTCCAGTATTCGGTTTCTCACGGTAATGATTACTA
TATCTATATTTTTGTAAGAGGCCGACAAAATGAATGCGAATTAATCCCCCAAGTGGCAACCCTCAAACACGCAAA