Description :
From Genome Similarity Track
Location :
Scaffold_177:81354- 84308
Transcript NameFunction/comments
g12008.t1hypothetical protein

Sequence
2954 bases(100 bases per row)
TTGGTACAACAGAAATTAATAGGGACAATAGGTACTGCCCTCGAAGGGATTGTGGCTGTCATTTCCGAATTTGCGCTGGAGGAGACAACCCCATGCCCAG
AAAGCGCGCTGGTTAAGAGAGTGTCGCGCCTGTGGCAGTGTATGGCTCTAGTAATGGCGAAAAACTTCAGCCGCTGTGCTATGGTGACGGTTGGAAGAGA
GCTTGAAGTGCGTCCGGATGACGATTCTGTGCGACATCTTCACGAGCTTTCGAAACTGTAGAATTCTAATCATGGGTCGATACTTGCGTTTGGTGCATTT
GCGTCGTACGCTGTCTCGTCGGTTCTCGCGTGGTGGTGGAGGCGAATGTGGTGTACTGTTTGTGGCCAACTTCGGTCATGGTTTTCGTGACGCTGGAGGC
GTTCGTGGCTTTGCTGGTTCTGTCCGAAGGGTGCGTATTGGGTGTGGTGAGCGGTGGTGGTAAGGACATTCACCGCAGTGTGGGTCCTGCAGTTGGAAAG
CCTGACGCTTGCTGTAAGAATCCCTTTTGTAACCATATCAAACTGATAAAGGGTTTTCTCCGCCTGGTGATTGGCTCATCGGCGACGGATGGTGATCAGC
GAGACAGACAGGAAGCAGTCGCCGGGCAAGAGATGCATCAACCGTTGGAAGCAACTGGCGGAGGCGAATAGATGATTATATCGAGGCTATTGGCGGCTGG
TGCTTCCAACAGTACTCGTCGAAGAACGACGAAATCGAATTTGGTCCAGCTGTAGCAGCGCACTCGATGACTCAAGAGAGTGTGGGGGCGAAAAAAGCTT
CGCTCGTGGATTCATAACAGCTGCGTAGACACAGAAACCGAACCTCGAGCGAAAGGTGGGAGCTGTCGGAGCAGTAACCTGAGCCTGAGTAATCACGAAC
TGAATGAACTGGCCATGTCTGGATCAGCGGTCTCAGCGAATCTTAGGTGATAGACTTGGCCAGGGTCAGTATTTGTCGGCGAGAGCGGGACTATGCGTAA
GTGTAGGGTCTGCTAGACCACTACTTAGCTTAACACTGTGTGCGCACGTGCATGAGGAAGCGTAGGAGATTTACGTTAGATTCAGTATGCTTGCAAACGA
AACGATCAGAATCGTGGTTTTGGTACAAGACCCGCAGTATGCGCACGTGGCACCGTAGTCTGGGCGTCAGGCTCTGAGGAAGCGACCAGGTTCTCGCCAG
TCGTGTACGGCGAGTAGCACTCGAGCAGTAAGTACACCACAAGCACGGCGATAGTGCCCACCTTTTCAACCATCGGTACATTGTCCTAGGTTTTGATCAG
GTGGAAAGCCACCGACATCAAGTAGCAGCTCGTCACCAAGCACGAAAGCCCCACAAAAGAACCGAGAAGTGGTCTCCAAAAAAAAGGGACACCACAACCT
GGATCGTAGTAATTGTGAATGCAGATTGTGGCGTTGGGTTTTGGTGCCGAACTGTCACGGTTTGGCTGACGTTGCACCTTTCAATGAACGGCGACAGAGC
GTCTTGATTGGCGGGTCTCATTTCCCGCGCTATAGTGACCTAGGAACAATAGTGACCGAGGTCTCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAAA
GCCTCGTTTGTATCCATTTCGTGTCGTACCCTCGGCTGTGTAGAGCCGGCCATACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGAT
ATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCC
GTCTTCGGTAAGTCTATCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTGGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGT
TGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGATAGGGGCGACAAGGAGTGTCGGTCCCTATATATTGGTGGAACCCGAGTGTTCCCAAGTGTATTT
CACTACCCGCCGAGGTTACCCTCGGCAAACCCGTATTAGGCGTGACTGCCGGTACCCTTCCTTCTGAGGGACTGCGGGGGTTCGCGCGAAGCGCAATATT
GCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGA
TCGTTCCTGGTTTTCAGGTGTTGATCCAACGTTCGCTGATCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTTTC
TGCGTGTTCCTACATGCCGCGACCCGGGATTGGTGTGACCTTCTGTGTGTCTTGGTTGCATATAGGTTCTTACCTTAACGAGCATTCGAGAGAAGAAAGA
AGAGAAGAAGAAAGAAGATGGCGAAAGAAGCGAAGTCAGCGGTACCAGCAACGCCGACGAGGTCAAGTGGAACGCGTACCGAGGGTTCGGGGCGTTCCGG
TTCGTCGTTCGCGACGCCGAGTACGTTGGCGTCGATCAACGAGCGTTCGGACAGTTTTGATGAGCCGATGGACTATTCTGACGCCAAGGAAGATGACGAA
GAAGATGACCTGGAAGAGAAGGCAGCTATGCCCGAGCTTTCGGAAGCCGCTGCAGTATCTGCAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACC
TCACCGAAGAGTTGAACGAAGTGGCTGGTCCCGAACCAGCCACCGGTTACGACGAAGATGAGTCCGACGATCACCGATCGTCGGCGATGGCCGAGGATGC
GAATTCTCGGCCGAATGGCGGCCGGCCTCCTCTTAACGGAGACACCCCGGCCGCCAACCGAGTTCTGGGTCGATACCTAGAACTCATGGAGGTGAAGAGC
AACTGGATGCGATCCTTCGCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGGAG