Description :
From Genome Similarity Track
Location :
Scaffold_148:81340- 83805
Transcript NameFunction/comments
g14662.t1RAW31155.1 Trifunctional enzyme subunit alpha [Phytophthora cactorum
g14663.t1ETP52470.1 hypothetical protein F442_02527 [Phytophthora parasitica P10297

Sequence
2465 bases(100 bases per row)
AGATGGTGGAGAAGAAGACTGGCGGCCACTACCCGGCGCCCAAGCTGATCCTTGAGGCAGCGCAGACGGGCGTGGAGCAGGGACTCACGAAGGGGCTGGA
GGTTGAGGCGGCCAACTTTGCCAAACTGGGCATGACCAACGAGGCCAAGGCGCTCATGAGCATCTTCTTCGGACAGACGGCGCTCAAGAAGAATCGCTAC
GGCAAGCCTGAGAAGCCTGTACAGACTATGGCTGTGGTCGGTGCTGGCCTCATGGGAGCTGGTATCGCGCAGGTGTCCGCTGCGAAGGGGGTGCGCGTTC
TGCTGAAGGATCGCGACGCTGCGGCTGCTGCCAAGGGTGAAGACTACGTGCGCAGCAACCTGGACCAGAAGGTGAAGCGCAATCGAATGACGATCTACGA
CCGCGATGCCGTCATGGCCAACGTAGTGCCTCTGTCTGACGAGGATGAGGTGTGGAAGACGCACATGAAGAAGGCGGATCTTGCCATTGAGGCTGTTTTT
GAGGACCTCTCTCTCAAGCACAAGGTCCTGTCAGATCTGGAGAAGTACGTGTCGAAGGACTGCGTGATTGCCACCAACACTTCGGCTTTGCCGATTGCTG
ACATTGCATCTGCTTGCAAGCGCCCGGAGAACGTGATTGGCATGCACTACTTCTCGCCTGTGCCGAGCATGCCGCTGCTGGAAATCATTCGCCACGCTGG
TACGAGCGACGCTACTGCGGCGAAGGCTGTTGATCTGGGACTTCGTCAAGGCAAGACGGCTATTGTAGTGAAGGATGTACCTGGCTTTTACGTGAACCGT
TGCCTTGGCCCATACATCGCTGAGACGTTGGCGCTTGTCGGAGACGGTGTGGAGCCGGAGAAGCTCGATAAGCTCATGACGACGTGGGGTCTGCCTGTGG
GCCCCATCACTCTGGCCGACGAGGTTGGTCTGGATGTGGCCTTCCACGTTAACCAGACGCTGTCCAAGGCGCTGGGTGTGCGTATGGATGGTGGAGATGC
CAAGCTGTTCGAGGAGATGATCGGACAGGGGTTCCTCGGCAAGAAGTCTGGCAAGGGCTTCTTCGTGCAGCCTCCTAAGGGCAAGAAGGGCAAGAAGACC
ATCAACGCTGATGCCATGAACCTTGTGAAGAAGTTCCAGAAGGAAGACCTGAAGCTCAGCGACGAAGATACGGTCAACCGCCTTATTTCACGTTTCGTGA
ACGAGGCTGTCCTCTGTGTGCAGGATGATATCATTGAGTCTCCGTCAGAGGGCGATATTGGTGCCGTCTTCGGTATTGGTTTCCCGCCTTTCATTGGCGG
CCCGTTCCGCTACGTCGACCTGGTGGGCAGCACTAAATTCACGGAGATGATGCAGCGCTACGCTGACCAGTATGGCGAGCAGTTCGCCCCTGCACCGCTT
CTGCAAGACATGGCCAAGACCAACAAGAAGTTCCACTCGAAGTAAGGCTGAATTCCGTTTATATAGGGAGATTGCGCGTGGATAGTGGTGGCGGCAGTCG
CTTCTAATCCTCAAAGCAGAAGCAAAGTAATGCAGGAAGAAATGCACATTTGGACTGATGTTTCATGCTAGTAGGGCTGGTCCATAGCCACTCAAGTGGA
GACACCATTCCTCTGATGCAAGTGAATTGGGGTAGTGAGCAAGGCGAAGCAAGGTGAGCGAATAGAACACGACGTACCAGCTTTGCGTGTACCTTGTGCT
CCCGCTCTTGGCTCTGTCGACGCAGATCTTCCACGCGCTGCAGCTTCTCGTCAAGCTCCACCACCTTCACGACGAACCCCAGCGCATATTAGAGTCCATT
AAGCCTATCTCAACGCATGCGGTGTCGTTCGTACCTGGTGCACATTGAAGCTTCCTGTACGACTGGGCTCAGAATCCGCCGCGTTCGCAGACTCGATCAG
GTCCTGCTTCATGCGGCGCACCAATGCAATACGCAATGCGTTCCTGCGGTCTTCCAACTCCGTTTTCTTAGCCTCATCTGCCGCCGCCGTCTTGCTCTGG
AGTTTTACCGCCAGCTGCGCAGGTGGCTCGGGAGCTGTGGCCTTCTGCTCCTGCTGGTACTCCTTTAGCTGCGCCTCGCGCTCGCGTTTCTTCTTTGCAA
TGATGAGGTCGCGCTGCTTCCGCAGATACTCTTCACGTCGCTTCAGTTCCTCCTCCGAGATTTCAGCAGCCTGCTGCCACTCGCGCTGTTTGCTGCGGTT
CTCTTCAAGCGACTCTTTGTTTCGCTTACAGATCTCCTCGGCCTTCTTCTTGCTCTCGCGAATCTGCTGCTGCACCTCTGCGGGGGAGAGCTGCCGGGTC
TCCGATGCAGCGCTCGCATACTTGTCTTCAGCTACTTTAGCCGCCACGGATGCGAGTCGCAACTGCTCGGTTTGCACACTCATGGACATGGCCAGCGCGG
CCTCCAGCTCGGCCTGCTCCATCTCCTCCTGCTTGTACAGCACACTGAGCTCCATGAACTGCGCC