Description :
From Genome Similarity Track
Location :
contig_93:81327- 83405
Transcript NameFunction/comments
g13218.t1hypothetical protein
g13219.t1RAW29671.1 hypothetical protein PC110_g13966 [Phytophthora cactorum

Sequence
2078 bases(100 bases per row)
AGACGCTCTTGCCGCCCAAGTTCCTGGCCCCCGGCCTCGTGGGCTCGCGTCCTATCCCGACCAATGACTGGTGGGGCAACCTGATCGGCGCCACGGTCGG
CGAGAAAACCGACGTCATCCAACCCGTGTGGACCAACCCGTACAGCGTGACCCCTTGCATCGCCATGGAGCCCTACGGCCTGACCATGAACTACCCGTAC
ACGACGCGTGATTCGGAGGCGGCCTGACCGGAAACGGCGATGCCGAGATGTACTACCTGCACGGCCAAGTGCCCGAGTTTACCTTCTCCGCCACCGAGTT
CTCCGACTCCTCGCACCCGAGCTTCGAGGTGTTCGACTGGGACGATCTGAGCGTGCAGCTCGCTTCATGTCCCGTGAAGATGATGCGAAGAAGATCGAGG
TGACTCTCGCAAGCGGCATGGCCTTCGTCACTGCTCGATACACTGAGCTGACGCCGCGGTTCCAGACGGCGTACAACATCTCGACCATCAACGGCCTGGA
CGCCACGGAGACCGTCAGCCTTCCTCTTACCAACAGCCGCTTCGTGCTGCAGTTCGACAACGGCGCAACCTGGACGCTGTACTTCTCTTCTCCGGTCGCG
CTGCACTTTGATGGCCACTCTGTGCTCGACATGGAGCGCCCATTCACTGGCATTGCTCGTGTTGCGCTGATCCCCGATGCCTCTGCGCAAGAGCAGAACG
TCTTCGACCAGACGGCGGGCTGCGTCCTCGACGGTGGCCGTGTTGAAGCCCACAATGAAGACGCCTACGCGTACGTGTGGAAGACCAGCGGCGACTGTGG
AAACGGTTTGCTGCACTACGCCCAGGTCCACCACATCGACACGCTGGATCGCAGATACGCTGTGGAGGCTGAAGGCGTAGCTGCTCACTCCACGACGCGC
GGACTGATGCAGGGAGTGGTGACCAAGACTGCGCCGCCCGAGTGGCGTCTTGTGGAAACGGTGGACTTCCCCGTTGACTTTTACCCGCCGCGGAAACCCG
ATGCCAGCGATGTCGAGTCGTACAAGATTAAGAAGACGCTCATCGCCGATATCGAGTCCGAGTGGTCGATCCCCCTGGGCCAGAGCTACTACTTCAATGG
CAAGGCCGCGCAGAAGTACGCGTCGATGTGTCTGATGGCTGGAGACGCCTCCATCGTCGGCGAAGACACCACGCTGCTCCCGCACTGCATCAAGAAGTTG
GAGAGCATGCTCACGCCGTTCTTGAACAACACGTGGACTAACGCGCTCAACTACGACACTATCTATCGTGGTGTGGTGAGCTCGCAGGGCTTCACGCTCC
ACGACGCCAACGTTGACTTTGGCAACACCATGTACAACGACCACCACTACCATTACGGCTACTGGGTGGTCACCGTCGCTATCATCAACAAGCTGGACCC
GACCTGGTCGAAGCTGCCCGAGCTGAACCGTATGGCGGGCTTCTTGGTGCGCGACGTCGCCAACCCGTCGGACGCGGACCCGTACTTCCCCAAGTTCCGC
AGCCTTGACTGGTATCGTGGCCACTCGTACTCGCACGGCATCACGGCGCTTGGAGATGGCAAGGACGAGGAGAGCACGTCCGAGGACATGAACTTTTACT
ACGGCATGGCACTGCTGGGCAAGGCCACAGGCGACGCCCACCTTGAAACGGTTGGCAAGCTCATGGTCAAGCTCAACGCCCGCGCGATCCAGACGTACTT
CCTGATCGAGGACGGTAACCGCGCCCACCCGGACCGCTACCGTGACAACAAGGTCATGGGAATCCTTTTCGACAACAAGGTCACCTACGCGACGTGGTTC
AGCGGCGAGAAGTACGCGATCCACGGCATTCAGATGCTCCCAGTCACGGCCGTCACCGAGTTTGTGCGCACGCACGACTTCGTCTCACAGGAATGGGACC
AGGTCCTGTCGCGCGAGCCGATCGTCCAGAACGACGAGCAGACCAACCCGTGGCTCTCGCTTCTCTACATGAACTACGCCACCGTCAACAAGGCGTTCGC
GCTTGAAAAGCTGCGCAACGTCACGATGGATGACGGGCTCTCCCGCTCCTGGGCGCTGTACATTGCAGCCACCCGGCC