Description :
From Genome Similarity Track
Location :
Scaffold_866:8132- 9556
Sequence
1424 bases(100 bases per row)
ACTTGACAGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTCGCAAAGC
TTCGGACAACTTGTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAGTCAATCAAGATTCTAAAGGGGTGATCGTACCCC
CGTACACATCCGTGTACTATGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCG
CGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTGCGTTCCCCTGTCCCCGGGATCCTGGCTTCTGCCAGCGA
CCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTGAAGTGGCCCATCTTCCCACAGCCGAAGCAGCGGATGT
CACGCTGTTTGGCGGACCCGAGTTCCATGGGAACTGGTCCGTTGGGGCTTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCGT
ACGCGCCTGGCGATGGCTGTATTCTTCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGCTTGCCTGCACCCGGAACAGCTGAGTGCGTGCGGGGCCC
ACTCGAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCATTGAATGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTGCACATACTCGT
GCAGTTCGCGCCTTCCTTGTTTAGACGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGCTGTTCGCACAGCTG
AGCCCAGGATGTGAAACATCCAGGGGATGTTGCTTCCCGAGTGTACACCCAACTCTTAGCACGACCGCTAAGGTTGGAGAGTGCAAAAGCAACACGCAGT
TGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTTCTCGGACCCAGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCATACGGCTTTACCTTCA
GCCGTATTGGCTTCGGGTGAGGCGGGTTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGC
ATTGACGCGCTCGAGCTGCTCAGCCGGTGTTGATACCACCAGGCTCTGCAGGGCCTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTCGAACTGA
GAGTCGTTCATATGGGAGAAGTCGTTCCTATCCATGGCAACGAACTTCGGAGGTTCAGGTAGTCTACCCGCGATGGCGTGAGATGTGACTACAAGTGCTA
CCAAGTGTGACGGGGTCACACAGC