Description :
From Genome Similarity Track
Location :
Scaffold_419:813162- 814602
Transcript NameFunction/comments
Aphin_H310_01123PREDICTED: uncharacterized protein LOC690384
Aphin_H310_01124aspartyl-tRNA synthetase, putative

Sequence
1440 bases(100 bases per row)
ATGACAACCAAGGGATGCTTCCGGAATCGACATGGGATCACCAGCGAAGGTGTATCCAAGCCCTCAGCACTGAGTGCCCCGACGTGTGGTATGGGCTACA
GTAGACGCCGAAGGACATGGACTGGTGTGACAGCCTTGTTCATTCAAGGACGAGCACAAACCACCCTGAGTTTACTTGTGACCAACGTTAGTGTATTCGC
ACAAGGCAAAAGAATGCAGGTGTTGGTGCCAACTTCCTCTGTCCTGACTTGATGAATCCTCTGTGCGTATACCCAACGGACAGCTTGTTTGGTCGTCGTG
CACATCAGAGCAAACGATGGCACAACATTAAGAAGACGTCGTGATCAAGAACCCACACCCCAACATTATGGTTCTTACAATATCTGGAGACATTGTGATA
GAATCCACTCCATCGAGAGGCCCTCACCCTGATAGATCTACCGAGTTGCACGATGAAGTCGACATAGGCGACTCTCAACCTATTCTTCGACGTTTTCCGT
GCCCAACCCCTTGTAGGTCGACACTTGGACATGTTGGACGAGGGTGTACAACTTTTCCTTGGCATCTTCGTCTTCGTTACGCTTGCGCGAGAGACGGACA
CGGACGCGGTAAGGAATGTTGCGCACACCTTGGGACCAGACGAACTTGTTCAACTTGGAGTCGATACGAACGTCAGTGGTGCCCATGGCCTTTTGGGCGA
ACTTCTTGATTTCGCGGACAGCCTTGGCAGCCTTCTTCTTGAAGGTACTAAAGCAAGGTTAAGGAAGTCTCCAAGGTGGGAGCTACAGATGATGATCTGA
AGAAACATGCACGTATATATCGTCAAAAAGGATACGCTCCATGCAGACGCTTGTGGAGGTTGATCGTGTAGTCGCGGGACACGACATCGGCCACCGTCGA
GGTCTTGGTCTTCTTCGTCGATTCTTTGGCCATTTTGCTTGAGCTCAGTAGGGTCAGATAAGGAGTAAAGCCGACGCTACCCACGTCGCGGTTGGCCACG
ACGCCGTCCAAACTCAAAGCCAGTCGTTTTGCTTCCCGACCCCTATGCATTTTGACCAATCCAATGCACATATTACACCAATTACTGTATCCGGATATCC
GGATAGATCGCTCTAGGAGCATACAAGGGCAACATGGTCATGACCTTTACTTCGTCTTGCCTCGGTCACAATTGCGCAGGTGACATCTATGCATCGCTCT
TGGCTACGCTAATGTGGTACTCGCTCAATTGGTCGGCGGTCACGGGACCTGGCGAGCCAGTCATGAGCTCGTTACCCGTGGTGGACTTGGGGAATGCAAT
CACATCGCGCAAGCTACGGCAGTCGTTTTAGCGCCGACCAGGGAGCACGAACAGCCGCGAGAATATACCTTGGAGCTCCGCATAAGATAGCGATGAGTCG
ATCCAATCCCAACGCTATTCCACCGTGGGGAGGGGCGCCG