Description :
From Genome Similarity Track
Location :
Scaffold_454:8131- 10528
Transcript NameFunction/comments
Phyci_578832Hypothetical protein
Phyci_21575Hypothetical protein

Sequence
2397 bases(100 bases per row)
gaaagagaataatctaagagaaaggcggttcagttgagaatacacgctggaccaagaccaacagggtggctttgccgcccagctaattgttgtcgattgt
tccatgtctgcgtgacctgcgcccacgcggccatttcgcttcaggttatgagcccaaagctcacgcgagggaaatacaacaactaagacaTCATGACGGA
GCAGAAGAAGGCACCCAAGGAAGCAAGTGAAGAAAAGAGGACGACCCCACCGTTTGACGGCAAAGACTATGAAGTCTGGCAGGAGCGAGCTAGGCTCAAG
CTGGAGAGGAAGAAGCTGTGGAAGTACTGCAAGGAGGGTCTGCCCGAGTCGGACGAGAGCAAGGAGGAGGAGGGGCATGCGACGTGGACGAGTGAGATGT
CCCATGCGAAGAAAAACAACTACGATGCGATGCCAAATACCATAATGAAGACAATCTACACAAATTTGAGTCGTGGAGCGCTTGAAAAAGAGAAGTTTGG
GCAAGACGTACTTGAAGTACGCTGAGGAGCAAGGTAAGTTCAGTCGTCTCAGGCTCACCTCCAACGGCAACGTACCCGATGTCTTGAGTGAAATGCGGCG
GCTGATGGAAATCATTGCTGCCGTCGGGCGCCCCGTGGATGAATACGTGAAACGGGCTATACTGATCGCTGCTGCGAGTGtacggccatgtcgtacaaac
attttttgccggccacaagccacaacatcctgacgatccgcccagctatgaacaacttgaactggcattggggatggctttcgaccattgctaaggtcgt
aaagcagaaagcaccaaggacaatgaaaatgaAGAAAAAGCGTTCTTGGCTGGTGGAGGACGCGGCCGTTGACGAGGTCGCGGTCGTGGTCGTGGCTGCG
ACCGAGGTGGGGGATCAGGTCGTGGTTCAGGTGGTcgtggttttggtggtcgaggcaaacacggtgggggtcgaggtggtgaccgtggccaaaccaacag
tggacagaaacggagtgacaactgctgtccttgccatgacgcaacacaccatgtacttgattgccctttcctagccaagcgaccttcagccgaggatcac
agcgatacacaagcacagaagcgcgttaagtTGTTAAGTTGAGTGGTGAAGAAAGTGCTAAGGCTGCGGAtaagggtaactatgctagtgagagtgatga
tagatcatatgttattcttcaagtgatgaaatgaaaagccggtcgcaggcaaagcccacgataactggtacctgaactccggggcatcgagtcatatctc
gaaccagctgactgattttgtggagttcacgccgcttagtgcccgagttcgcgttggaggaaagaattcgcggagtgtagaaggtattggcactgtagtc
aaagagataaagacctctggtaggagGCTACTGTGCAGTCCCTACTCAGTGCGACAACAATTGAAGCAATATCTGCCTGAACGCGATCGTGTAAAGATGA
ACTTTGATGATGCAGATCGCGCTGATGTTATCCTACACTCTGGGGTGACTATCGCTCAAGTTGATGATACTAATCTGTATCGGAGAGATCACGAGAGGTT
GCCGTGGCGCTACCAATCCAAGTGAGCAGCTTGGATAGGTGGCATGGGAGATTGGGGCACCCTAGTAAAAATGCATTTAATGCACTGTTGAGCCATGATC
AGTGGCCACATATGAATTTGCAATTGCGAGACCTGTACTCGAGCACCGTTTGGAAGTGTTCCAAAAGTTTGAGGAGTACTATGAGCGTACCAAGACGCCG
TAACACGAATGAAAACGATGAAAAGAGACAACGCAAACGGGTTCAAGGAGCTGCAAAGTGCATGCGAGTCGAAGTATGGCCTGGAGTTTGGCAGcagtat
caagcatacttcggagcaaaatgctgtcgcggagagaatggtccgcaccattacggagcgaatgcgaagcatgattgtacacttcgacctaccagaatcg
atgtaagctgaggcagcgatgacagctgcacactacgtgaatattatgtccagctctgtgggaggcatgaaggttccatatgcagtgtggcaacgcctgc
atacgagaagtttcagacgttcgcctgcgctgtcctgttgtatgtagacaaggctggacgccaaaaagatgcagccgaaggcttgggatgcggtcttgat
ttggtattcgcgagggaagcgaggctaccgcttgctcgatagcaagaccaataaggcctctacagtcatactgttgtcttctatgagaataaagctggac
gaactcagctttgccgccaagttcagcctctacagcagaatattttggagttgatagcggagtatgatattgagccgatgctggatgaaatgcatgc