Description :
From Genome Similarity Track
Location :
Scaffold_698:813- 5583
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_698-fgenesh-gene-0.0Protein pianissimo A

Sequence
4770 bases(100 bases per row)
CGCTCGGCCCGAGGGCGGCCTCGGGCTCATTTGTACGCTCGTGGAGCGCGGCGGACTCGACCGAAAGTCCAAGCTCGAGAGCACAGGACGGCTCTGCCAT
GTACGAGCGACTGCGTGCTGGGTGGACCGTGCCCCCTTCATTTCCTGACGCTATGCTTGTATCCATTCGATAATATTCAGGAGCTCAAGACGGACCCGAT
GCAGCTCGATTCGTTCCCCGTGGAGCGCATCATGAAGTGCATGCGCAAGCTCGTGAGCGATCCCGACACGTCCACCCGTGCCGGAGCACTGCGCGTCATC
CGGTACGCGATCTGCAGCAGCAATGGCGTCAAGCAATTTGCCGAGACGGTGAGTGTGATCACTCCTGATCAACTCCTTCTCTATCCGCGTCACTAACCAG
GACCTCTGCTATTTCCCTAGACGCTCGGTGTGTTTGTCGTGCGGTCCATGGAGCGCGAGCAAAAGCTGCTGGCCGAGCGCGTGCAGGCCATCAAGGTGAT
CCGCCGCATTATGGAGATTGACGCGTCGCAAATGCCGCGCAATCTGGTCGCGTCCATCGTCGCAATCGCGAGCCACAAAGACGACAATATGCGGCGCGTG
TGCTTGGAGACGCTTCGGGAACTCGTGCTGTCCAATGTCGAAGTGGTCGCATCGGCTAACGGCGTCAAAGTCTTGGTCGATGCGATCCTCGAGCCGTCGT
TCCAAGACCTCGCCGACTCGCTCATCTTGACACTGCTCATGATTCTCAATGAGCCGGCGACGAGGCGCTTTATCGAGCCGTTCATGGACACGCAGATTCT
TCTGGCGCCGTTCACCGACACTGACTTGCCCGCGGGCAACGAGCGGCGCCTGCGATGGATGGCGAGCCGCAACGCTATTGTGACCATGATGCGCTCGTGG
ACGGTAAGGGCATAATCACTCACGATGATCTGAAAGATAGCCGGCACCTAATGGTAGATCATTGTGTGAAGGGTATCGTGGTGCTGACGTCCAACCCACA
AGGTCTTCAGTCGCTGGTCCAGTTGCTTGTGCAGCCCGTGGGCGAAGATGTCCAGAAGGCCGTGCTCTCGACCATTTGCGAAATCTTTTACAAGCGCACG
CCGTTCGACAAGGCCGCGGGCAGCGACGCGAACGACATTGTCTCGACGGCGATCCCCATCAGCGTGTCGTCGGCCGAGTTTAACCCCGTGACATCGCAGC
ACAACCTGCTGGACAATTACACGGTCATTAATCTGCTCGCGATGATCCACTGCGGCATCTTGGACGCGCTCATCACGCTCGGCACGAGCACGAACCGCTC
GCTGGCCGAGCCGGCGATCGACTTGCTCTCCGACATTTTGCGCATGTCGTCTCGCTTGCTTCCGGACCAGCACTGCGCGCAGCTCTTGGCGTTGCCCCGA
CTTGTATCGGCCACGTCGGTGACGACCACGACCACGCAGACGCTTGGGGACCATGTCAAGAGCCTACTGGAACGCATGCAGCGCGAGAAATCGATCCGTG
CGAGCGAGATGCTCGCGGAACTCGCGACGGCCGTCGGCGCGAGCTCGGGAAGTATCGCGGCACAGGGCGTCTCGCTGGTCTCGTACGGTGGTAGCGGTGT
CAACGGCGTGCAGCTCGCGTCGGAACTGTTGAGGGATACGAACCGTCCGTCGCCGCTCCTGCTCAACCGCACGGGTGCCTTGACGAATTTCTCATCGACG
ACATTAAAGAAAGGGCCCATCCGGGAGAACGTGACGTCGCGCGAGCTCATGATCCAGACGCTCAAGCTCTCGATGGACGCGCAAATGGACGACGCGACAT
TCAAGGACATGCTCAATAACCGTTCCCGCGTACTCATGGACAAGAACTGGACCAAGTGGAACTGGGATATCATCTCGGAACTGCTCGAAGGACCGCTCAC
GAATCCGCAACGGCTCTCCGAAGCCATGAAAACGAAGTTTTTCAAGCGCCTGTCGGGCTTTTTCCGGTGCGACCCTGGCAACAAGGGCTACTTTTCACAG
CTTGCGTGGATTCCCGACTTTGTACCGTTCCTACGTCCGGCCTGCCAAATGTATACACTGCTGCTGAACCACCCCGAGGGTCTGCTTTTCCTCAAGACGG
ATCGACGCGGCCAGCTCTTGACCGAGATCTCGGCGGCACTCGAACTCGAGGCGCGGCCCGAGGCCGCGATCGTCGAGTCGCACATTGGCGCATTGAAAGC
GCGCATGTTTTCGCCCGAGTATTGCTCGCGACGCATGCTACGCGAGTATTTCACGCTGCTTGGGCTCATGAGCTCGAGTAAGGAAGGGCTGAAAATGATG
GAACAGTCGAACCTCTTCCAGCGGCTCTACGTTATGGGCACGACCAAGGGCCACGACTTTCTGTGCCGCCTCATTCTCGCCAACTTGGACTACTCGGTCG
ACGGCAGCTCGCGCAAACTGCTCCAGTCGTGGATGCTCGAAGGCTCGAAGCCCTTGCGGCTCTACGCGACCTGTCTCTTGCGCGCACTGCTTCGTTCTGA
AGTGGCTGACTTTGCCAAGTGGGGCATTGACGCGCTCGTGACGCAATTGACCCAGGAGGAAGAAGTGGCCAAGGCCGCGCTTAGTGTCTTGGAAGAAGCC
GCCGAGACGGAAGAGTGTCTCCAGGCCATGATTATGAAGCGGCCCACGCGCCTGATCCAGCTGCGCGACAAGCGCGCCGAGTCGCTCTTGCTCAAGTTTC
TCTCGCAGCCCGAGGGTCTGACGTTTCTCAAGGACTGCAATGACTGGATCCCACAAATGCTCTTGGCGTGGCGTCGCGAGAAATTCATCTCGTACGTGAA
CGCTGTCGAGAGCGCGCTGTTTCGTGGACTCAATCGCGATGTTTGTGGCCGGGAGCGAAACCTCTCGAGTGCCACGGCGAACAAGCCCTGCCGCCCCACG
CCGATTCCGGTCCACGTGCCCATGAAGCGAGGGAACAACCTCAAGGCGAGCAACCAGCGATCGCTCTGGGGGCTCGAGTGGCTCTACCGCATGCCGTGGA
ACATGGAAGTCAAGATTGTGGGACCACCAGGCAGTGGCCCACCGTCCAACCTTACCTTGGAGACGTATATTGACGGCTCGATCCGTGATGAAGAAGACAC
GCCACTGGACGAAGACGACCTGCGGATGAACTCGATTCGCGTGAAGGGCATCGTCGTGGACGCGCGCAATATGCCGCAGCCAGTGATTGTGAATTCGCAG
CAGACGCTCCAGGCTTGTTTGTTTCTGGGCACGCAACCCGTGGACCGCCGCGGGTTCACCAAGCCGCCGCCGCAGAGTAACGGTGGCTTCGTCATGTCGT
CCAATCTGACGGCGGACCCACAGCTCAAGGCTGCGTCACGCGCGCGCACGCAGTCAGCTGCCGGCGGTGGAGGCGAGCGCCTTTCGGAAACGTTTTCTAG
TGCATTGGACTACCAGAATGACGCGTCGATCCCGCAGCCCGAGGCCGCGTCGGACGAGAACAAGGACTGGAGCGTGTGCTCGCCCGACCAACGGTCCCCT
CAGAATCTCTCGAGCCCCGAGACATCGCTGTGCGGCACGGGCGAGCGTGCCGTGTGGAACTTCCGCGTCGAAATGGACCAAGCGACAGGCGGCGTCAAGC
GACTCATGCTCAAGTCGGTCGAGTTTACGCTCCAGCTGCTGCCTCTGCGGCCGCGCACGGTGCCGCTCCCTCCCCATCTCTATGGAGAGCTCGCCAAAAC
CACGCAAGGGTGCCAGATCTTGTTGGAATCGGGCCATATCCCGGAATTCATTTCGTGTCTGCGCGATGCCGCCAGTGTGCCACTGGAAAAGCGAGCCGCG
TTGTGGGCGTTGGGCCACGTCGCTGCGACCTCGAGGGGCTACGATCTCATTTACCACTATGCCCACGACGTGCTGGATTTGATTGTCAAGCTGGCGACTG
ACTCACCGATCGTGTCGATCCGTGGGACCTGCTTTTTTGTGTTGGGGCTGGTCGCGCGGTCGTCAGCCGGACGCCGTAACCTCGCGCGGCTCGGCTGGGA
CACGGCCCGCGACACGCAGTGCTCAATCTCAGTGCCTCAGAACTGCAATTCGCTGTTTGTGTGGCCACAGCCGCCCGCGCACGGCGCCTCGAGCGCTGTC
TGCAACGTGACGCACCCACCGGCGTCGCATCTCCAGACACTGCTCAGCAAAGTGCCGCCCGAGTGGAAAGACGTGCTTCGCCTCGTCGCGGATCTGAGCA
ACCACATCACGCAAAAGGAAGCGCACGCGTCACTCAACAAGTTGCGTGCGTCCAAGTCGAGTCTTTTTGAAGAGCCCATGTTACTGCTGTATGTGCACGC
GCTGCTTGAGCGATACAATTACCGACTCGCGCTTCGCCAGTTCGTTCTCAATTCGTTTGATCGCGCCGTGCTGACGGACGAGGTCTTGGACTCCATCAAT
CAAGACGAGAGTGGAGGCGGCTACAAGACGAACGCTGGCGACAAGGTGCCCCATCCACGGGATGTGCTGCGACGCCGGTCGTCCCCAACGATCCCGTCGT
TTACGGCGTCCGTGCAGTCGCTAAACTCTGTAATCCAGGGTGGCAATGCGCGCATGTCGACGACCAACGGCATGGGGCTTTCGCGGGCTTCGGCCGTGAT
GGGGGCAGGCGACATGCGCACGAGTGTGCGCATGACATCGACCAGCATGGCGCCGATGCCGGCGACGGTGGACCCCGTGGACCGTCTCGTCCTGCTCAAG
CGGAGCCGCAAGCGCAGCGCCAACTCGGAAAAGACGATTGTCGTTGGGGCCCCCGAAGCGGTCGTCTAAG