Description :
From Genome Similarity Track
Location :
Scaffold_1513:813- 1843
Transcript NameFunction/comments
Phyke_g11930hypothetical protein

Sequence
1030 bases(100 bases per row)
TTGCCAACCATCGCATTCAAAGAGCTGTATCGCTATGCTACAATAATGGACAagttgttcctgttcctcGGTGTGATCATGGCCGGTGTGAACGGAGCTC
TGTTCCCTTGCATGGCGTTGGTCTTCGGTGACGCCATCGGAGCTTTTGCTCAGCCTGGCGGTGGTGTGGACATTGACGCCGTCAATTCCGCTGCATTGGA
CTATATCCTCATTGCCGTTGCACTCTTCGTAAGTGACTATGTCGCTTACGTGGTCTTTTCGAACTCGGCTGAGAGGCAGATGAAGGCGCTGCGGGATGCC
TCACTTCGTCACATGCTCTATATGAACATCGGTTGGTACGACAGTAGCGATCCGTTGCAGCTCTCAAGCCGCTTGACTGGAGACACAGTAAAGATCAAGG
ATGGAATGGGACAGAAGCTCGGCGACTCCGTCAAGTACACTTGCCAATTTGTAGCCGGTTACACGATTGGCTTCGTTCGCGGATGGGATATGAGTCTCGT
CATGGCGTGTGTCATGCCGCTCATGGTGGCGTCGTTGGGTGTGCTGATGACGAGTCTGCGCAAGCGTGCTGTCCACTCTCAACAAATGTacgctgaagct
ggtgcagtggcGGAGGAGACACTTGGTTCGATTCGCACTGTATCCTCTTTGAATGCTGAGAAGCTGGCGATCGATAAATACAACGACCGCGCTTCAAAAG
CTGAGGAGACCAACATTCAAATGGCAAAGTTTTCGGCGGTGGTGTTCGGTCTCTTCATGTGTAGCATGTGGCTCATGTACGCCGCTGGACTTTGGTACGG
CGGATCGAAAGTCGCTCATGCTAAGGCTTCTCCGTCTGACGTCTTCCAGTCCTTTTTTGGTGTCTTGATGGGAACGATTTCGATGGGCCAAATCATGCCA
AACATTTCAGCTGTAGCAGAAGCTAAgggtgctgcagcacagatCTACAAAATTCTTGATACGCCTTCAACCATTGACGCCTCCCAAGACGTCGGTGACA
AACCGGACTCCTGCTCTGGCCACATCGAAG