Description :
From Genome Similarity Track
Location :
Scaffold_55:81292- 84019
Sequence
2727 bases(100 bases per row)
CCGACCTTCTGTGTGCGCAAGGTCACAGGAGGATGGCGAATAGTGCACGCGTTCAACAAGTCGAATCCTGCAACGGTACCGGCTCAGACGCCGATACCGA
GGAAGGACGTAATCATTGATAGTATGTCAAAGAGTACCATCTTTTCGTCCATGGATCTGATGGATGGCTTCTATCAGATTCTAATGCGTGAACGGAACAT
CCCCTACACGGCAGTAAGCACCCCGAGCGGTATGCTCTAGGAGTGACTAGTAATGCCACAAGGGCTTAGTAACGACCCTGCCACCTTCAACAGATGCGTT
AAAAAAATCTGTTGAGACCGGTGCGAGACTTTGCGCCAAGTAACTTCGACGACGTATTCGTCCATAACCGGGATATGGGCGGAAAGACGGAAATAGAGTT
TCATAGAACACACGTTTGTCAGGTTCTTACACTTATGCGCAAGCAAAAGCTGTATGCCAACCTCTAGAAGTGTATATTTGCTGCTAGCGAAATACCACTT
CTTGGGTGCATCGTGGGTAAACACCGCGTAGGCTCTGATCCTGAAAAGATCAAGCTGATTACCGACTGGCCCGTGCCAGTCGACGTTAAGGGACTAAGAA
AGTTCCTTGGTTTAGCGGCGTGCTTACACAAGTACTCGCGCAACTACGCTAAGATGACCGTTCATCTCTCTCGTCTTTTGAAAAAGAACGAGAAATGGTC
ATGAAACATGGATTGTCAGCGTTCCTTTTAAGATATCAAGCAGAACTTGATGCAATAGCCCATCTTGGCGATTGCAGACCAACACAGACCATTCCATGTG
GTCCGTGACGCCAGCAATTTCGCAATCGGTTGCGCGTTAATGCAGTACGATGCAGACAGCGCAGAGCGTGTCTTCTGGTATTAATCGCGTCAGCAGCAAG
CAGCTGAGCGTAAATATCCAGTACATGATAAAAAACTCCTTGCCATGAAGTATGTACTGGCGAAGTTTCGCGTCTATCTCCTTGGAGATAAGCCGTTTGT
AGTCTATACGGACCATGCGTCATTATGCACAGCCGTAAACAGTCCACACCTCTCGCAAAGGATGGCGATGTGGCTGTCGTTCTTTGTGGAGTAGAACTTC
TCCGTGGAGTACAAACCCGGACGACTTGATGTCATCGCGGATGCGTTGTCGCGCCGACCCGATCTCGAGTCGACTGCGCAGTCCAACAGTGAGGTTGATA
CCACTGTTGCAACACTAGTCACTAGTTTCCCGTCGTCAACATTGCTTAACGACATAAAAAAAGTCTTACGGAGAAGATAAGGCTCCTCTGCGACTAATGG
ATCATCTGGTGACTTCATTTCGTAAATCTCTCAAATATTTACAAGCCTTGTATCGATCTTCCGTGGATCGATACACAACACGCAACGGTTTGCTGTATTA
TAAAGCCGTTACCAGCGACACACCTCGTGTCGTCTTCCCCACTCATAATGAGTTGCTCTAACGCATCATGTATGAGTGCCACGATTCACCAACTAGTGGG
CATCATGGGCGTGAAAGACTTATCTCACGGTAAGTCGCGACTTTTATTGGCCCCGCCAGTATCAGTTTGTGCACAAGTACATTCGTGCTTGTGAAGTGTG
CCAAAGGGTGAAGCCTGGTCGTTCATCCCGTGCACCACTACAGCCTCTACCATCCTGGCAGAGTGCTGGCAGTCCGTTTCAATGGACTTCGCCTTCGGTT
TTCCCGAAGACGCTCACAATAATAATGGTATTCTTGTGTTCGCAGACCAATCAGCAAGATGTACCATCTTGCTGCAGTTAATGAGTCAATCTCAGCACAT
GGCTTTGCCCACGTCTTCATTGACACGGTATTCCGACTCCACGGTCTACCCCGTGAACTAGTCTCTGATAGAGATCCTCGGTTCACGGCGACGTTTTGGC
AATCCGTGTTCCGATCCCTCGGAACACGTCTGACTATGTCTACTTCTGACCATCCCGAGACTGTTGGTCAGACAGAACGCGTCAACCGCGTCCTCAAAGA
GATACTTCGAGGATACATCCAATCTTTCACAGATTGGAGCGAATTTTTGCCGATGGTGAAGTTTGTAATCAACAACTCAGTGCATGCATCTACAACTCGT
ACACCATTCTTCGTGAATGGCTTACGCGATCCCCGCCTTCCCACCCATTTAGGGTGTGACACTACTTCAAGGAAGGAAGGATTCGCTCTATCAACAACCG
TTCTGGCTCTTGCTCATCACGTGTCGATGTAATCGACGACGCGAACGTTGCCGATGTCGATCAAGTCGACATCGAAGAAGATAACCTTATCAATAGTGAT
AACACTATTTCTAACCCAGATGAGGATGACCTCCTAGCGGTGCGCACAAGGCGCACTGCAACAAACCAAAGTGATGCAGCAGAAGATTTCTTGCTAGCAC
AAGAAGCAGTGGTCCGTTTTGTGCAAGACTCCATCGCTAACGTGGTGGACCGACAGAAACGGAATGCTGACAAATATGGAAGAGCAAACGTTCTTCTATT
TAATGTCGGAGACTTAGTTCTACTAGCTACGGTAAATATACCTAAGCACGTAATAACTAATATGAGTAGAAGCAGACTACTACCGAAGTACATTGGCCTG
TTCCGTGGACTACGTCGCAAAGACAATGCGTACACGATCGAGTTGCCTCGCAGGATGCGTACGCATCCTACGGTTTATGTCGGTCGTCTCCGCCCGTACC
ATCACCACGAGGTCTCTTCCTCGGGCG