Description :
From Genome Similarity Track
Location :
Scaffold_10:81273- 91395
Transcript NameFunction/comments
Phymu_g792hypothetical protein PHYSODRAFT_343916
Phymu_g793hypothetical protein PHYSODRAFT_476538
Phymu_g794hypothetical protein PHYSODRAFT_552380
Phymu_g795hypothetical protein PHYSODRAFT_284317
Phymu_g796conserved hypothetical protein

Sequence
10122 bases(100 bases per row)
CGGAGGCATCTTATCCTCCTTTTCTGTTGCTTTGTGCAGCATGTTCGAACGGTTACCGCCTGACGCAATAGCCGAGTCGCAGCTTCGCGAAGTCATGGAT
GCCACGCTTGCAATCCTTGACCACCCGTTCGCACTGGGAGACTTGACCCGAGCTCGTAACGCTGTGGGTTTCGTGCTGCGCTACGGACTTAATGGATGCT
TAACAGAGCGCCAGCAAGaggtgctgcttggagcttATCTACAAAAACTACGAGATGAATCGCAGGCTTCAGAACCGAATCACCACAAGATACTGTCGAC
GCTAGTGGAGATGAGTCACATGTTCCACTCGATGGGCGAGGCTTGTGTGACTCATGCGCGTGATGCCAGTGACGTGCTGCAAGGGCTTATTTGCCATGAA
AAACAAAGCGTTCGCTTCCAAGCTGCCATCGCGTTGGCGTCTCTTGTCACTGCAATTCCGTACCGGCTTCAAAGTGTGCTGACGAGCTGTCTTCAGGGTC
TTCGTGATACTGCTGAGTACCTCATGCGTGGAGGGTCTGACGTCGAGGAACTGAGAAGCTCCGAGTCTGAAAAGGTAGAAGATGGCCAAGAGGAAGGCAA
CGACATGCAAAGCAAGACCCATCTGTACGCGATTCAAGGGAGATCTGCGGCCATTGCCCACATTCTTCGTGCCATTAAGCTTGATGGCAATGGTGGCTTA
TCTCAAACCACAATGGACGATATTTATTCCATCTCCGAGGAGCTTGTCGAAAGTCAGTTCCTGAATGAATGTGCGGACAGTATCTGGCTCACCTGTACGC
GCGCTGGCTGGACGTTGGTCGGAAGTCTTGTGGCCATGAATGATGAGCAGTGGACTAAGATCAACCTGGAGAAGCTTTTGAATCTTTGGCTCAAGTCCAG
CGTGCTGCATAGTCGAGAATCGtctctcgagctcctgcgtATTGAAGCCGCCGTCATCGCTCTGAGCAGTTTCCTTGCCAATTGTCAGAATGCAGCTGAA
AACTCTGACAGCGACGTGAATATTCTTGCGAGTCACGTACTCCACGTATACTTGACGGCGACCCAGGACACCCTGAGCAAACCTATCAAGCGTCGCGGGC
AGATTGCACGATACCGTCTACTGGGATGGATCATCAATTGCTTCTCGATGCTCCCTCCAATTTACAGCGACTCATACATCGTCCTGTTGGATCTTATTGC
TGAATTCACTACGGCCCAGGCGTTGATGAACCTCAGACATTCGTCCCTGGTCCCAGCAAAATCCACATACCTCCAAAGCGTGCTTTCTTCTGACGATGAC
ACGCTTGACGTTGTGACCCTCTCGCGGTTGAATCCTGGAGACTATCCGTCGCCGCTCTACTCAAGGGAGCTGAACCTTGTGCTTGGCTTGCAGCAACGAG
AAAATGCTTTGACGGATACTGAGCTCGAGGTCCAATATCTCGACACGTTTTTGAGGTCAATGACTGAAAAAGAAGCTATCGATGGTGTGACCAAGcgagc
aagttgcagtccGTTCACTTACGTTCGGCTCGTGGACACTAGTGTGATTTTGTTTGGTCGACTATTCCACTCGATTCCAGAAGATCTTCAACTGCGATGT
CTTCAACACTACGCCGGCGCTCTATCCGATGTTCGAGCTGATTGCGAAGTCAACGTGTGTTCGTTACTGTTCGCTGTGATTGCAGAAGCAAGGCGTCTGG
AGAAGTCCGGTACCGCCTTaacgtcttcagcgtcgctTTCAGCAACATCGTGGCCTCTTCAGATGCAAACGATGCTGTGTGAAATGATTTCGAGTGAAAA
CACGGTGgttcgtcgtggtgctggtgagGCACTTGGCTCTTTGGCGGTGATTCTAGGGGAAGACCATTGCAAGGGGCTGATTatcgagttggagaagcgT
TTGGTGGTGGATAAGCTCCCACAAGGGGCCTCTAACGCTACTTTCGGCGCCGCCGCGGACTTAGATGTGTCTGTTCTATCAGCTGGTGCAGCCTTTGCGT
TAGCATGCATTAAACGCGTCTGTGGATCCCGTATCTCTATTGACACCGGTCTCATTTTCCGGTTTGCAGGTGAATGCTCTCAACCTCTGCGGACTTGGAT
CTTACATGCGTGGGGCATCATTTTACAGTCCGTTAATTCTACCGGAGGCGACTATGAGCAGTTTGTGAACTCGACCTTTTCGTTGATGGAGGCCCACGTA
TTGGCTGGTTTTGTGTACTCCAAGGTCAACAAGCGTGGACAACGGTGGCAAATCAGCACTATAGTTGCGCTTGGAAGGATTATTAACGATGTGGTGGCAA
CGCTCGGCCCGGAGCTTGACGGCTCGAACGACCGCTTGAATGAGTTCTACTCTTACTGGatgcttcttcgccaagatggagacgcgcgtgtggagctgca
gttcttgAGGTTCCTGGAGCAAGTCGTTGTGTTTGCACCGTCGCGCTTCCAAGCGGAAGATTTACGCTACATTTTGCGCATCATTTCCGATACTGCTCTG
CTGAATTCTGGAACTGCATCATCGCTCTCATCGCAACAGACCTCTGGATCTTCAATTTTGTCACCGCCATCAGGAAATGGGCCGTCTTTGGCTACTTTGG
GCAACTTTGAGCCATTTCAAAATGAACTCGTGAGCGTCGGTGTGTATACGAACGGCTGGAGCCGGAGCATCCTGCAAACCGTGGGTTTGTCGTGCATTCG
CACACTGGTGGAGAGAGATCCAACATTAATTCATCGTCAGAATCTGTTTTGCCTGCTGTTCTCGGCACTCCACGTCGAATACAACGAGCTGATGTGGGGC
TACCTGCCTGGTCTCCATGGTATGTGGGACGTTCTCTCCTTCGCCTTTGCTGATTCTACAACCATGCAGCGAAATAGCATTGCGGTGCTGCAGAGCGCGG
CtctggcgttgctggacgtCGAAGGCAGAGACCACGAGAGCGCCGAGCCGTGTCTCTGGGCTCTATTGTGTCGTAGCATTTCTATTGGCGAGTCAGTAAG
CACTTTTTCCGGAGGTAATGCGGAGGAACTCATGATGAGCCCGAAAGGAATGATGGCCGGGATTCAGGTACCAAGTTCTGACGCAGTAGGAGATGACGAG
GCGTCTTGGTCACCAAACCCAGCGCTGGATATGCCAAAGACGGATGCAAACTCGCTGGCTTCTGCTGCTATTGCCATTCAAGTGAGTACGTGGCGAGCTA
CCAAGGCCAGTGTGGGGGACCTCATGGCATTGATGCCGCCTCTTTCTCGCCAAGTCCGTCATTTCGCAGTGGAATGCGTGCTGCGAGTTTTTGAGCTGAT
GGCAGCAACCCCACCAATGACAACTGACATGGGCcagaacaagcagcttcactttGACCTCATAGCGGCAAGACGTTATTTTTTCGAGATGTTATCCGCT
GGGGCAACTTTGCCTGCATCCACCGACCCCAGCGTTGGAAATTTtttgtgcatgtacttggaCGAGTTTGTAACTCTTGCTTGCCACGTCGCCACGActt
ctgctgaaggagacgagCTTTTAATGTTCCAGTGCGCGGGACTTCGGCTACTAAATGTGCTGGTGAAGAATTTTGCGTCTGCGCGTGATCCGGAGGTGGC
CACGGGTGATGCTTACTTGTTGGACCCATATCGTGCCCAGCTTTCGTCAGCTATCCGCCATGCTCTGAAGCAGGTCCAAGTGGAGAGTTCACCGTTGACT
ACAGGCTTGGACAATGAAAAAAGGGAGGAGGGTTACTTTTACGCACCACTTCTTCTCGAGGCGCACACTATTGCTGGTGCCTGTATCTCCGCTCATCTCA
TCCAAGACAAGGTTGGCTTGGGACGTATCCTGCGAGCAGTTGTCACTCCAGACTATGGCCATGCTCATTTCATTGGAGATGAACTTACACGCACTTCACT
TTCACTTGCCAACTTGGCTTCAGTGGGAGAACTTTTttcctccagcgtcactgAAGCGATTGCGCAAAAGGATGCACGTGATGATGAGCATCGAGCAGTG
GCTGTATCTCCGCTGGTCAAGGCGATGATCAACGGCTTATCGGATTCCGCGGAGTACTTGTTTAAGTGCTGGATGGATTCAACCTTTGCCTATGGCCTTG
TGATGCAAGGTTCTGCACAATGGGCACACTTGGacacaagctcaagcgcagcGTTACTGAGTGACGAGGTGATGGTCATGCCAGCTTTACAAATGCCGCT
CCCACCGATTGGTGCCGTTACGAACGTTCCGACAGCCTCGTTGTCCTCcgtcaaggagctgccgGCGCTTTACAAGCGATATTGGCCCAAGATCGTCCAC
GCGATGGCAACTTTGGAAGTCTACTTGCCTAAGTTGGTCTCTTTGTGTAGTACACAAGATGGCAACATTCCGAAGTGGTCGTCTGTCTTGCTGTCAAGTG
CGATCTTCCACGTTAACGCAAACGCTCGCGATCGAATGGAGGATGAAGGGGAGCTGCCGGCCGTTCTCCGCAGTATCCCGTTACTATTGAGAGCTCTGGC
TGAGAACCCGCCTAACCAAGGTGGCTCATCCTGCGATTTCGCGGTGCTCTTGACAGCTGCGCTGAATACGACAATGCTCGCAAGTAAGCGGTGCTCGGGT
CTTGCTCAAACGGAGGCCCTGAAGGCGATGTTCTCCTGCTTATCGCGTGAAAACCTCGCTTTTGCTCGAGAAACCTGTGGTTCTGGAGAGGACGGAGAAC
agcgctctgctgctctgttCGACACCGTAGCACTGGCGGGATTGTGCCCAACTGAAGTCGTTTGTCAAATATGTGATGCCACGGAGCAGACTCGGCATGC
TCGTGCTGTCAGCATCGGAAGTAGAACCACTGGGGTCCGTCGCATTTCTGTTGCAAGTCTAGAGGACACCAAGCGGATGACTGAAATTGTGCAGTTCGCT
ACGAGTGGGATCGTACTGCTGCACACGACTGAAGAAGCGCGGTATGGTGTGGTGCGCTCAGTGGCTTTAGTGCAGCAGGCAATTTGCTCTGTTGCGGGCG
ACTATTACTCTTCCGTTGTTAAGGACGCTGTGGCGACGCTTAGTCGTGCATCAACCGAGTCGGTGCTTGCTTTGGCACGCACACTTGAAACCAACAATGA
TTCGTCTGGCGTTCTTTCCCGTATCAAGTCAAGTGTACGCAGTTGCTTTGAGTTCCTCGCTGAATGGATTAAGGTAGACATCCACACTGCGCCAGGGTTC
TCGATGCAGGTTGTTGCGAATTATGCTGTGAGCTTCCCGTCTTCCGTccaagaagatgcagagcgTTTCCATGCTGAGGTTGCAGAAACATCCGTCGCAA
CGTTGGAGCACAGTGCGCTAGGGGGTGGAGATAGGAAGCAGCCGCACTCTGCTACTGCAGAACTTCTGGGCGGTTTGCACGCagtcgtgaagaagctcgt
cgacGTGCACCAAAGTGCCATTTTGAATCGCTATCTGGTGGCTCTCGGTCCTTCTCTCGTTGAGATCGTAGGCGTATCAAACGGGTATCCCGAGACACCA
GGTGAGCTcgctgaactggacgaggccGAGGGGCTTCTTCGTGTGCTGACGATGCAGTTGAATGACCAACACGGCTCCACGTTTGTGCACATGCTGCTTC
CGAGACTCGCGGCTGTACTTAGCCATCCGCCGCCATCAACTGTAGACAATGCGGTGCCTGCGCAAGTTCCTGGTATCTtggctcgactgctgctgtgctt
tgCTCAGACCCACGCCGCTGCGTTCAAGGGTGAGGTGGCGGCCATGACTCCGACGTTGCGTGGAGTACTAGAGACTGCGTTACGTCTTGCTCTCACTGGA
CCAGTCCCTGCCGCTGGGGTACGTGGACAGCCGTCGCCTCCACAGGTGAGCAGTCCTGCTGCCAAGCTTGACCTTAGCCGGTACAATTAACACGTCAAGT
AACCAGAGACTCTGCAGCTACGTAGAGAATGTTTTAAATGAGTGGATTTTCATACATATCGCTAAAGAGCACCTTTATCAGTGCTCGGTGTGTCAGGTCT
CGATGCTAGATCGGTTGAGCTGGTTAAAACTCATAGCGTCGTCTCTGGACGGGAAGTCGTGGCAACATTCTGCACttccaagagctccagcaagcTGAAT
AGAACTGTGTGGACAAGTTCCATGCTGTAGAGCTACAAAAAGACAATTCAGACAACAAAAACAAGTAAAATACTTAACCAATAACGCACCTCCACGCCTC
CGTCCAGGTCCACAGCCACTTCCTGCATTTCGACTCGCTCGATCTCGTAAGTGGATAAATCAAAAGGTAGCGAATCGATATACAGTCGCTCTACCAACTC
GATAAGCTCTGAGAAGAATATAACACGTTAGCAATTGATCACGGACAGTATTTTTGCATCACGTACCTGGTACGTAAGCGGACGGGCGGTTGCCTCCAGG
TCCGTCTTTTGTCTGATGAAAAAGACGACGTAGCGTGGCCCACGGAACTGTCATTGTGTATGTGCGCACAACGTCGCCTTCCTTCGTCGCCCGGTACTTA
AGCAGCACCGGCGCTCGTGGTGGATCTTGATTTGCCATGGAGCTACCACGCGGCtctccatcctcttcctGGTTATTGACCTCGTGCTGAACTCTGGACA
GTCTTGATCCTTCAGCTAGAAGACTTGCCACGACCCAATTACGCGCCAGACGTTTGAGGTTCATTTGCTGGATGTGCACGACGTGCGTATTGACGACACA
CTGGAAGCGGCGCTGCAGCCATGAGCAGACCCAACGTAGAAGCTCCTCGTTTCctctcagcagcagcacttgctgtcTCTCGTGTCCTTTACGCGGGGcg
cgctgctcctgctccgtcgGGAAGTATAGCACAAAGCCGCCCGTGCGCTCCGGTCCTGCTTTCGCTTCTCTGCTACGGCGCCGGTCGCGCTCTTCGCGGA
TCTGGAACGCTACAAATGCGTCGGTATTGCGGATGCTCACGCTGTAGCCGAACTGCTGGCCGCACGCGCGCAGCGCCGCGGCGCGCAGCGTCTTGACCAG
GTCGTGCGCGTACTCGCTGAGTTGTTcgcgctggaagtggaagagcgGCGACGCGCAGTGCACGACCCAGCGGCGGTCCAGTAGCACCTGTTCCATGCTC
ACGCGCTCGCGTTCACGGCgtgcggcagcttctcgcggCGTCTCCTGTTCATCCGGAGCGCCGCCGTCCTCCGGTGCGCGCGTGTACTGTGACGGCCGCA
TTGGCGAACTATAGGCCTctcggagcttctgctgctgcgcggcTGAGATCCTGGCGGGCGGCTCTGGGCGCGAGTTCTCCATGGACGGCGACtcgacttc
ttggctgctgttgGGACAGCAAATTGTCATCATGTAACGGTTTATGCGCTGTGGGTGGACTGGACTTCTACGAAAATCGATTGAAGCAAATGAATTTTTA
CTAAAGCTGACGTCAGTGACCGGACCTTGTGGTCGCTGTGGCGTCTGCCATGGTCGCTTGCTATTAAACCTCCCTGAATGACTGGACTACATACGAGTGT
GCTTATCCGCCggcgagaagcaggaagatgAGGATCACCACGAGCACGAGAATGATGAGGTACAGCTTGGTGTTGTTGCTTTGCTTGGCCACCTAgagat
aaaaaaaacattagCAAGACGACACATGCATAAATAGAGGAGGATCTATCGTACCCGTGCTGCGCGCGCACCCTCAGATTCGAGTCCATCCGTGACGCGG
GATACATCATCATCGATCTCATTCAGCAGCCGCACGTGCAGATCCGTCTCGTCCTTCACAGTCAAGCTGTAGGTACGCAGGTTGGACACGCCCTGGCCGA
TCAAGTCCAGCTGCTGATCCTGGTCCTTCATAATCTGGTTTTGCATGTTCAATAGTCGCGCCGGTGCATCCGCCGCTCCAGGACTGCAGTAGCAAACACG
GTGTCAGTCTCTGAGCGTTGCGAACCTCTATTTCAGCATGTCAACCCACCTCACTGCAgccttcgacgtcttccggCTGTTATACATATCCAagtcttct
tgctgcagtcaAACACACAGCATTCACTACGTCAGTAACGCCACTCCAGCCCGAAAACTTCGACATTGTGTACCTGGTCTTGTGCTAACTGGTTTAGCAA
CCTTTCGCGCCGCTCAATTTCCTGTTGCGTCCTGGAGTATTAGCACAGAAATGACGTAAACTCGCGTACCTATTGCATTTCATTCATACTGGCAGCCTCG
TACACTGAGCTGGAGGACCGCTTGAGCTGGTCGAAGTCGCGCTTGAGCCGCGAGACGCTTTGCTGCAACGCGAAGACGCTGGTACCGATGGAGCCTGAGT
TGCCTGTGCGGATCTTGCTGGACAGCACCTGTTCCTGGCCACGCGCGTTCTCTAGCCGGtccagccacgacgcccacgCCGTCGTGCTCATAGTCGCCCT
tatggagctgctcgtcttctctTTCGAAATCTTTTCGCCTGATTATTGGATACCGGTTTTGTACCAATATTACCGGTGGAGAAGCGGTAGTGGTGCTCCA
CCCTCCATTATCGGCACAAGACACTAAAAAGACCGAAGGAAAGATGAGCCAGCGGGAGTTCGAGCgcaagatggaggagcacATCGAGGAGATGCGCGTG
ACACAGACCATCGCGTACTTCAGCCGTACGGTGGAGCTGTGCTTCACGGACTGCGTGCACGCCTtccgcagcaagaagctggacgacaaggagacgTCTT
GCGTCAACAACTGCGCGGAGAAGTTCCTGCGCCACACCATGCGCTCCTCCGTGCGTCTGCAGGAGAGTTATGCCGAcatcatgcagcagcagcaggacca
GCAGAAATAGACGGCTTAGagcggcggtggcgtcggacagaggagaaggagatgcagtAAATGAACACCAATTACGACGCTCGAAACGGCGCTTCCGATC
TGCTTTCTGTGTTGTTTTTTTACTGCATGTACACAGCGTTTATTAAGGTATGCATGTAGCGCTCGTGGCGATGCAAGCACGGTGCTTGAAGCACCTCGCA
AACACATTCCTGGTTCAACAACTCCAAGTTGATATCCCTGGGTTTAATGACATATTGATATTTGACATATTTTATTTACCTCTTTTTTTAAACCTTTAGA
AAAATCCCGCCCAATTTCGAATTCCCATTTCTCCGTTCTCCCCCAAAAAATGGCATCGTCCCCAACTAGCATCAAGTCCGACGACGGGCAGAACCCGACA
CCTCGCGGTTTTTCTAAGCGCGGTGATGGCTTCTCGGTGCAGGAGACTGAGGGTCTGCTGACGGAAGTCCGCGAACGCTGGCAAGAGGGATGGGACGTGA
TCGCAGAAGTACACAACACGCAGTTCCCGGGCCACAAGCGCACGGCCGGCTCGCTCAAGCGCAAATTCGCCAAGCTCTACCGCACCAAGGTTGACTCGAC
caccaaggagaagcacgCGCGTGCCGCCgccatggccaagaaggtgcgCGAGGAGATGCGCATCCAGCGACGTGGACTCTCGCCCGCGGCGCGCGGGCTC
GGAGACGACCTGGTTGCGGATACTGACGCTGCTGTAGGTGTGCAAGGGGTGCACGAGGACCTAACTGAGGTCGAAATTATCGGGTCTCAAACCGCAACAC
AGCCTCAATCGCTGGCTGAAATCCCAGTGGAGCATGAGCTGCGCCAAACATTGGCACAGAGTGGGCCATTGACCCAGGGCACGCCGGATGCGTGGCAGGC
GGCTATTAATCACTGGCCTATTGCCGGTGAATCTCTGCGCAGACTGCGGTCACGCGCTACGAGCGGCGAGACCGCGTCCACTCAGGATTTGGCGCAGACG
ATGttgatggtgctgctggattCCCAACACCAACACGACTTAGAGCGGAATCAGGAACGCGAGGAGAGGcggctggagaagcagcgctggcagGAAGAAA
TGCGCGAGCAACAGCGTCGGCATGAGCAGGAGCGCATCGAAGATCGCCGCCGCAATGAGCAGTTCATGCAGGTGATGACGACGCTTGTGGCACAGATTGC
AGCTGGCCAGCAGCGCGGCGGATTGAATTGAGCGAGGCCGGTCCACGGTTTTGCATGCAAGTGGTGCTGAGTAAACAGACCGAGGCAGCCTGGGTATGCT
GCATAACATTGATAATAGTTGT