Description :
From Genome Similarity Track
Location :
contig_22:812505- 814056
Sequence
1551 bases(100 bases per row)
GATGCGGTGCGGCCGCATGCGGCCGGTTGAGACTGGGCCTTAGGATCCCATGCGGTGCATTTGGGTGCGTGTGAGACACGCACAAATAGAGTGTGTTGTT
GGTCGTGTGGCTGGCGTTCCGTAGCCCAAGTGGTTAACGGGGTTGTGTGCAAGCCAACTCGCGCGGGTTCAAATCCCACCATATCAAGGATCGCATAGCA
TGCTTTTGTAGCATGTGGGATACGCATTGGGATGGGCATTTTTATGGTCCCATAGGGCTTGCAGGACAGACAGGTAGAAAGTAGAGCAGACCAAGTTAAC
TCAATCAATCTCACTCACTTTTGGTTTTTCAATCTCGGCCCGAAGCCGTCTTCTCCTACCAACCTCCGCACGCGTAGATAGCCAACTGCCTTTTGCAGGT
GTAAGGTGATCATCCAAATAAATTCAACTCCAGTTAACACGGTGGTGTGTCTAAGTGTGGAGAGCTTCGTTATTTCATATCCCCCACTCGCTGGTCATTC
TGTTTCGGCGTGGTGTTTCATTTTTTTCGGGAGGAAAGTGATCTTCCCTGATGTTTTCAACTGAGCAATATCCGGGATAGTTATTCTCAGAGTTGCTGGT
TTCGTGGCACAAGTTTCTGGATAGTGGCTCCCAGACTTTCTTTCTCGCCTGGATAAGCGTGGTCCGTGGAAGTCCTAGCGTGACGCGAGCGCGCTGGATT
ACGACAGCTATCCCAGATCAACAACTCGCAATTCCATCCCAGACTCAGGGTCGCAAAGAGGAGAAGTTAGAAATTGAGTCGGACTCCCGGATTCCGGAAG
TCACTTCTGTCCCAGACTCCGGGTAGCAAAGAGAAGAAGTGAAGTGGAGTATCCCGGTTCTGAGCCGGAACCGGAAGGAACAAGAGCAGAGGTGGTATGC
GGTTCTAAGCGGAAACGTAGGAGGAAAAAGAAATGCCATCAAGACCTGGTCCAAGGTCTGGAAAGAAGAGGACAGAGTTTGTATGAAGTGAAGTTTATAT
ATCAAGAAAAAACCGGGGCGTTTGGGGCAAGGCACGTACCTGTCAAGCAAAGACCAAGCTTCACTCGGCTGCATTTGGAGATCACTCGAATCGGAGGCAT
CTGGTGTGACCTACGTTTGTCCGAGCCCACCGCGTAGTCTTAGAAAGAACCCAAGGCAAGAGATCACAGGAGGGTACACACACGCCCACCTGACTTCCAT
TCTGGGGAGTCGAGTGATCCGAGCTCAAGGTAATCCGAGAATCTGCAGGCACCTCACCACAGTGACGCAGCTCCCGATGGAAGCTACAGCCACCAGTCCG
AACCTCACCACTGGGAATTTGGCGACAACTCCGACAACTTCGATTCCGACGATCAAAATGAGGATTTCTGTCACTTCATTGAGGCTAGAGGCCATCAACT
TAAAAATGATCATCGTCCAGATCCTCAAATTGAAGGCGAAGAACCTCGTCCTGGAGACGCAACCCTCAAATTGAGGGTTTTCAAGGCCGTCCCGGTAGGA
GCAACGGTGGTTCCGGTGGTGGCTACCACCGATCCGCACATGCAAAATCGG