Description :
From Genome Similarity Track
Location :
contig_93:81250- 83328
Transcript NameFunction/comments
g10781.t1putative endo-1,3-beta-glucanase
g10782.t1putative endo-1,3-beta-glucanase

Sequence
2078 bases(100 bases per row)
AGACGCTCTTGCCGCCCAAGTTCCTGGCCCCCGGCCTCGTGGGCTCGCGTCCTATCCCGACCAATGACTGGTGGGGCAACCTGATCGGCGCCACGGTCGG
CGAGAAAACCGACGTCATCCAACCCGTGTGGACCAACCCGTACAGCGTGACCCCTTGCATCGCCATGGAGCCCTACGGCCTGACCATGAACTACCCGTAC
ACGACGCGTGATTCGGAGGCGGCCTGACCGGAAACGGCGATGCCGAGATGTACTACCTGCACGGCCAAGTGCCCGAGTTTACCTTCTCCGCCACCGAGTT
CTCCGACTCCTCGCACCCGAGCTTCGAGGTGTTCGACTGGGACGATCTGAGCGTGCAGCTCGCTTCATGTCCCGTGAAGATGATGCGAAGAAGATCGAGG
TGACTCTCGCAAGCGGCATGGCCTTCGTCACTGCTCGATACACTGAGCTGACGCCGCGGTTCCAGACGGCGTACAACATCTCGACCATCAACGGCCTGGA
CGCCACGGAGACCGTCAGCCTTCCTCTTACCAACAGCCGCTTCGTGCTGCAGTTCGACAACGGCGCAACCTGGACGCTGTACTTCTCTTCTCCGGTCGCG
CTGCACTTTGATGGCCACTCTGTGCTCGACATGGAGCGCCCATTCACTGGCATTGCTCGTGTTGCGCTGATCCCCGATGCCTCTGCGCAAGAGCAGAACG
TCTTCGACCAGACGGCGGGCTGCGTCCTCGACGGTGGCCGTGTTGAAGCCCACAATGAAGACGCCTACGCGTACGTGTGGAAGACCAGCGGCGACTGTGG
AAACGGTTTGCTGCACTACGCCCAGGTCCACCACATCGACACGCTGGATCGCAGATACGCTGTGGAGGCTGAAGGCGTAGCTGCTCACTCCACGACGCGC
GGACTGATGCAGGGAGTGGTGACCAAGACTGCGCCGCCCGAGTGGCGTCTTGTGGAAACGGTGGACTTCCCCGTTGACTTTTACCCGCCGCGGAAACCCG
ATGCCAGCGATGTCGAGTCGTACAAGATTAAGAAGACGCTCATCGCCGATATCGAGTCCGAGTGGTCGATCCCCCTGGGCCAGAGCTACTACTTCAATGG
CAAGGCCGCGCAGAAGTACGCGTCGATGTGTCTGATGGCTGGAGACGCCTCCATCGTCGGCGAAGACACCACGCTGCTCCCGCACTGCATCAAGAAGTTG
GAGAGCATGCTCACGCCGTTCTTGAACAACACGTGGACTAACGCGCTCAACTACGACACTATCTATCGTGGTGTGGTGAGCTCGCAGGGCTTCACGCTCC
ACGACGCCAACGTTGACTTTGGCAACACCATGTACAACGACCACCACTACCATTACGGCTACTGGGTGGTCACCGTCGCTATCATCAACAAGCTGGACCC
GACCTGGTCGAAGCTGCCCGAGCTGAACCGTATGGCGGGCTTCTTGGTGCGCGACGTCGCCAACCCGTCGGACGCGGACCCGTACTTCCCCAAGTTCCGC
AGCCTTGACTGGTATCGTGGCCACTCGTACTCGCACGGCATCACGGCGCTTGGAGATGGCAAGGACGAGGAGAGCACGTCCGAGGACATGAACTTTTACT
ACGGCATGGCACTGCTGGGCAAGGCCACAGGCGACGCCCACCTTGAAACGGTTGGCAAGCTCATGGTCAAGCTCAACGCCCGCGCGATCCAGACGTACTT
CCTGATCGAGGACGGTAACCGCGCCCACCCGGACCGCTACCGTGACAACAAGGTCATGGGAATCCTTTTCGACAACAAGGTCACCTACGCGACGTGGTTC
AGCGGCGAGAAGTACGCGATCCACGGCATTCAGATGCTCCCAGTCACGGCCGTCACCGAGTTTGTGCGCACGCACGACTTCGTCTCGCAGGAATGGGACC
AGGTCCTGTCGCGCGAGCCGATCGTCCAGAACGACGAGCAGACCAACCCGTGGCTCTCGCTTCTCTACATGAACTACGCCACCGTCAACAAGGCGTTCGC
GCTTGAAAAGCTGCGCAACGTCACGATGGATGACGGGCTCTCCCGCTCCTGGGCGCTGTACATTGCAGCCACCCGGCC