Description :
From Genome Similarity Track
Location :
contig_80:8125- 10003
Transcript NameFunction/comments
g12112.t1POM58554.1 Hypothetical protein PHPALM_36782 [Phytophthora palmivora var. palmivora

Sequence
1878 bases(100 bases per row)
GCTCTCTCATTGGCTGAAGTAACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCT
CAATCAATCACTTTCGAATCTTCGTTCTACCCCTCAAGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCT
TCACGGTGTCCAAGATCCATACCTTCCATCAGGTTATGAGCCCAAGCACCATGTCCTCTGCCCACGACGCCTCCACCAAGGTCTCCATCGACAAGTTCAA
CGGAGACAACTACGCGACGTGGAACCGCTACATGCGTGGCGTGTTCCTGACCAAGTCGGTGTGGCATGTCGTGAACCGAGAGACGACGCCGAGCTTCACG
GACTCGCGGCCCAAGGACGAGTACGTCAAGTCGAGCAACATCGCGTTCGGACTGATGTTGCTCCACATGGACGCGGACTACCACCATGTGGTCGACGACT
GCGAGGAAGCGTGGGTTGCGTGGACGCGCCTGAAGACGCTGTACGGTGGTTCGCAGAAGGCTGGTCGCATCTACCTGAAGCGCCAACTCTTCAGCATGGA
GATGTCGGAAGGCGGGAACGTGTTGCATCACTGCAACGAGGTCCTCAACATCAGCGCCAAGCTCAGCAGCATCGGCGCCAAGATGGAGGACGAGGACGTG
GCGATCTGCCTGTTGCGCAGTCTCCCCAAGAGCTACGAGAACGTCGTGCTGAACTTGGAGATGAGCAGCGCTGAGCTGCGATCGCAAGACGTCGTGAAGG
TGCTGACGAATGAGCACATCAAGCGGCAAGGCGAGAAGACGGCGACGGTGAAGACGGAGGACGCGGCCAAGGCGTTCAACACCGACCGAGAGTCTCGCCA
GTGCACGTACTGCGGGAAATTGGGGCACACGGTCGACAAGTGCTGGACCAAGCAGAAGGACGAGAATCGGGGCCCAAGACGCGGCGGCAATGGCAATGGC
CGTGGACGCGGGGCCAACAATGCCCAGTGGAGGAACGACGACGCCAGCTACGACTACGGCTACGGCTATGATCGAGTGGCGTTCGCGGTCTCACTGGAGT
GTGGCATTTCGACGGGCAAGGATATGCTCGGCATGTGGGCGGTCGACAGCGGCGCAACGCACCACATCTGCAACGACAAGGCCAAGTTCGCCCATTTGAT
TGAGCGAAACGAGGGCGAACTTTCGGTGGCCGACGGCAACAAGGCGGCCATCATGGGTGTGGGACCATCGTGGAACGAGTGGTTCTGCCCAACGGCGACG
AGCGCGACATCGAGATCAAGAACGCGCTGTACGTGCCGAGCATGAGCAAGAATCTGCTCTCCGTGCCACAGATCAACAAGAGTGGTCTGTTCCAAGTCGT
GTTCGACGGCACCCAGATGCGCGTTGCCCACAAGGCCTCCAAGCAAGTGGTGGCGGCGGCGAACCTCGTGGATGGCCTCTACTGGCTCCAGACGCCTCAG
CGATCGGCGAATGCGGCGACCAGTGGGAAGACGGTCGACCTGCACGCGCGTATGGGTCACGCTCCGGTGGAGGTGCTTCGCAAGATGGTCGACAACGACA
TGATCAAGGACGCGAAGGCACCTTCCAAGTCGAGTGGACCAAGCGTGTGTCGTCGCGGCTGTCAGAAAAGGCTTTGGTCGGTTGATGGCAAAATGCAAAG
TGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTACCGGATACTGA
GTTGCTTCAGCCAATCAGCGACTGCCACGTGGATGCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATC