Description :
From Genome Similarity Track
Location :
Scaffold_2144:812- 3229
Sequence
2417 bases(100 bases per row)
CTTCCTCCTAATCCACCCTTCCCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTGGCCCACACCCTT
CTGTGGGCCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGGTCCCTCCCCTACTCTTCTTCATGAGACTGCATCACGCCAAATCTGTTA
CGATTCGTACGATTCCTCAAGAAAGCATAGAGTAATAGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACC
AGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGACCTCATATCGGTGATCCTCTCGACTTCGAACTCGTCGTCCTCGAGATCCACATTCC
CCGGTAGGAGGACTTCGTCGTAATCCACGCGGTCGGATACATCCACTGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGA
TACGTGTACCACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCAGCTTTACCGCGTGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCAT
AGGTGGGCTAATTTGCGGGCATACCCCTCTTTCACCCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCATCTTCGTTGT
GTCGATCCGCTCGACCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTGGTATTTCTGGACTTGGTATCGCCATCGCCTTGG
ATCTCGGTTCCTCTTCTTGGTGCTGCAAACTGGGATGGCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAACATGGGGTATCACCCCGG
ATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGAAGCCGCTCTGCGTACTCATCCCAATCCTTCTTATCCAAATCCTGGACATACATCTTGAGCGCTCTCG
TGATTGTCTGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAA
GAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAACCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTTTGC
GCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAAATCCAACCAAATCAACAATTCTGGGTTTCCTTTGAACGACTTGGGCAACGAGG
GGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATC
CACGCATTCACCGACATATCGTTGTACGCTCTTGAATAGTCCTCTACAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCG
CCTTCCAGGCTAGCATGGTAGTGGTGTAGGACATCATGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCG
TAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTAGTATCCTCCCGACTCAGGTCTCGTACATC
CCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTTTGTGCTTTGAGGATCCGCTCAATACGGACTCCCTTCACAAATGTTTCCTCGAGG
ATGTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTTCTTTTCCTGGATCCAACTACCACCACTTCGTCTAGTCGGT
TCAATGTAACGAGATCCTGATGACCGGCTTCTCTCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCCGCACTGGCATTCCA
ATCTCGCTTGACATGTACCAACTCGTGATTCATCCAACCACGCAGGTGGACCATCACTTTCTGCCGTAACAGTGTTAGGGCAGGGGCCTTGCAGTCAATC
TAACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCTTGTTACTTTAGTAGATCCAAACCCAGCAGTAGCCCGT
TATACTCCGCTTCGTTGACGGTGAGGCCTTTCGCATAAGTGGATCTGGCCCGTACTACTTCCCATCCAGGTAGTCTCCACAGTATCGCACTGTACGCCCC
GCCTCCGCGTCGTATGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGC
TCTTTCTTAGGGGCGAT