Description :
From Genome Similarity Track
Location :
Scaffold_285:8119- 11211
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_285-abinit-gene-0.33Tetratricopeptide repeat protein

Sequence
3092 bases(100 bases per row)
GGAAAGCATGGACGACGAGGACGACTTCTTTGCCGAGCTGTGCGGCGTCTCGGTCTCGGACATGGGCACCGCGGCCGAGGACGAGCGCGTCGTGCTGCAG
GACGCGTGCCTCGCCATTGAACGCGCCGTGATCGAGTCGCGTGCTGCGCCAATCGACGCGTCGCTCGCACACGTGGCGGCCATTCCTGGGGAGACGCAGC
GCCTCCAAGCCGCGCTCGCGCTGGGGAAGCTTATCTGCGAAGGTAGCTATGCCGAGATCGTGCGCGGCGAGATCGGACAGCGCGTCGTGCAACAGGCGCT
GCTGGCGGTTCAACCCAACGAAGACAAGAACCAGCACTTTGCGACGCGGATCGCCAAGCGACTCGAAGCCTTTGTCGCCCATGGCAGCAACAACGATCAC
GAATTCGACCAGTGGGCGGCGAGCTACGAGGTCTTGTTTGTCGCGATTGCATTCTTCAACCTGTTTGTCCAGGCCAATTACACGGGGCCCGCTATTGATC
CCGACCAGGTCAAGGATCTCACAGCGATTGCAGCGCAGGCGCTAGGTCTCGCTGCTGATGACGATGCTGGGAAGGCTCACCGCGAGGCTGTGCTGGTGCT
TCAAGTGGACGGAGAGAGCCCCTTCACGATTTGCGAGTTTCCGTACTTTCTAGCTCTTGGCCGTGCGATGCTGAGTTTTGCTGGCAACGCACGATTTTCC
AATTGGTCGGTCGCCGTCCAGCAAGTCAGTTCTGGTGATGACGATGACGATGAGGATGTCGCAGCGTCTCCTATTGTCTCATTGGAGCTGCTGGCCGTGC
TCGACCAGCTACAGACGGCGTGCTGGTGGAACGCTCGTGCTGCTGTCGCCCACGAGCGGTTGCTGATCGCCAAGGAACCGTCCACGACGCTGTGGTTTGA
AGCGCGCCGCGGCTTTGCCACGACGCTTCGAAACCACACGACGCTGTTTGCCGACACGTCCGAGCCTCAGCACGGCGTCTACTTGCACACGCGTGCGCTG
ATCGAGTGGGGGCTCGCGCAAAACTACTTTGACAAGAACAAGCAAGGCAAGCGCACGTTCCAAAAGGCCCATGAGGTCAGTGGGCTCACGGTCGAGCTCT
CGGGGTCCATGGGCAAGCGCACAAAGTTCCAGCAGAAAAGCGTCGCGCAAATGGTGCTGCTCGCAGCATCCAAGTATCCGCCAGTAGACAAGGACGCTCC
GGCGTCGGTCTACGCCAACGCCATGGCCGATGCGACCCACGCCGACTTTGGCGGCCGCAATGTGGAGCAGCCTTCGTCCACGGGGCCCGATAGCGAGCTC
ACGGAAGAAGAGCTACGTATCCAGCAGCTCGTGCAGGACGGTGAGGCTTCGTACCGAGACATTCAGCTCGACCAAGTGGACCCGGACAATATCTTGCTCG
AGCAGATCCACTTTGAAGACGGCTCGCTGCTGTCGGCGCAGGGCAATTTGCAGCCCATGGACCAGGTCGTGCTGCTCTCGCTGTGTCTCGACGTCAAGAA
CAGCAATGCCGGCGACGGACTCACGCGGGAAGAGATGATCCCGTACGTGACGCGCGTGCTCGAGAACCCGAACAACTGGATGATCTACTCCACGGGGCTG
CTCGAGCGTGCATGGATAGAGTGCGAGTCGGACAAGCGCCGCGAACGCGCCGTGCTGCAAATGCAGGCGCTCGTGGACCAGCATACGACGCGGCTCACGG
TGCTCCAGAACTCGCTCCAGGCCATCGAGGACGCTGCGCCCGTGAGCGAGCGCATGGCGTTTGTCTATGCGCTGGCGTTCCCACCGCGGTACGCACTCAA
GCGCGACCTCGCCGAGCGGTACTCCAAGCTCGGCGTCATGCGCAGCGCGCTTGAGATTTTCCTCGAGTTGGAAATGTGGGACGACGTCGTGCTCTGCTAC
CAAGTGCTCGACCAACCCACGAAAGCCGAGCAAGTTGTGCGTGCGCGTCTCGCGGTCGCCCCGACGCCGTACATGTGGACGTGTCTCGGCGACCTCACGC
AGGACATTTCGCACTACGAAACGGCGTGGGAGCTGTCGGGCCACCGCTTTGCGCGTGCCAAGCGATCGCTCGGGCGGCACTACTTTGAAAAGGGCGAGTA
TGACACGGCGATCCAGCACTACTTGGCCAGTGTCGAAGTGAGTCCGATGCACAACCCGGCGTGGTTTGTGCTGGGCACCATGTCGATGCGCACGCAGAAC
TGGGCGCTCGGGCTGCGCGCGCTCACGCGCGTCGTGCAGCTCGAGCCGGACAATGGCGAGGCCTGGGGCAACATTGGCTCGATCCATCTGACCAACGGCC
GGTACGCCGAGGCGTTCAGCGTCCTGAGCGAGGCACTCAAGCAGAAGCGCGAGATGTGGCAAATGTGGGAGAACTATGCGTTCTGCGCTATCCAGATTGA
GCGGTACGGCGAGGCCATGTACGCGCTCCACCAGTGGCTCGATCTGCGACACAAGCACAAGCGCAGCGTCGACCATGAGCTGCTTGCGTGGCTCGTTGAG
GCCATTGTGTACCCAGGGGAGCTGAAGAAGGCCGATGCGGTCAAGGAAGAAAAGGAAGACGTGGGCAGCGTCATGGAGGCGGCCATGGATCTCGCCCAGC
AGCTCAGCAAAGAGGACGACGACGAAGAGGAAGAAGACTTGGCAGCTCTCGATGAAGCGGCGCTCGCGACGGATGCGACGCCACCGCAGTCGCATGCCAA
CTACAAGAAGCAGCTCGCCCTGTTGTTCGGCCGAATCACGACCATCTCGACGAGCAACCCGAAGATCTGGCAGGTGTACGCGCACTTTAACGACGGCGTT
GGCCGCAAAGAAAAGGCGCTCGACTGTCGGCTCAAGCAATGCCGCGCGCTGCAGATCGCTGGCTGGGAAACCGAGCAGACGAGCGTCGACGAGCTTTGCC
GCGCGGCCGTGCGGCTCGCGCAAGACTACATTGCGGACGGCTCAAAAAAGGCGCTGTACGCGTGTCGACTCTACATTCGCGGCGTGCTGAAGAAGGCGCA
AGTCGACTTTGGTGAGCTAGAGGCTGTGCAGCAGCTCGCGAAGACGCTCGAGCAGGTCGAGACGCTTGAGAAGCAATTGTAAGGAAGTGCGT