Description :
From Genome Similarity Track
Location :
Scaffold_128:8119- 11084
Transcript NameFunction/comments
g17142.t1hypothetical protein

Sequence
2965 bases(100 bases per row)
GCACTCCGTGAGGGTCAGAATGGTGAATGACATGGAGTCGAAACTCATACGTCGGCGTAGAGCGCTTGTACTGCCGAGCGTAGCGGCCTCCACCTTCACT
TGCTCGTGCGCGCCCCATGAAGAGTTGGGAAACGACTGCGTTTTAGTAGTCTGGTGCCTAACTTTTATGGACCCATGGCCACCAATTTTTGGAGCTGTCG
GAAATGACAACGAACCGGTGGTGTCCAAATTGCAGTCATCCGATTGGCTAATATGGCTTGTCGGATATAACATTCTATCGGATACTACACAGGTTATACG
GTATGGGTTTCGTACTTAGCCACATTTTAACCAATGATTGGCCATAGAATATAGTACTGAGTGCTCACTGGACAAATCTCGACGGCCTTGAATTGACCAA
ACGGCCCCAAATTGGCTGTTTACCTTAGTGTTACAGTATTTTATCTCGAATTCTTTCTGCTCTACCTTTTCTGATACGAAGCAGCAGCGAATATGGATAT
GTTTTCATCTACCATGAAGTTTTGGGTTATATGAGAGTTTAATCTGGTTGTCCGTAGAGAGTGATGGTATGTGGGCTACTGTGGTTTAGCTCTATCATTA
GGAGATTTAAAAGGATGACATCCTGCATGCAGTGGCATACTGCGATATATTCTGCTTCTACTGTAGATAGCACGACTGTGTGGTGTTTCCTAGACTGCCA
TGAGATTGGACTGCCACACATGTAGGTGATATATCCTCCTACAGATCGACGTGTGTCGGCGCAGTTAGCATAGTCTGCATCTACAAAATCAGTGAGGTAT
TGCTTTGTGTTATATTGCTCTAGGTTTTCTTTTCCTCCTAGGATAATGCCGAGGTTACGTGTACCATTTAGGTATACAAGGCATCTCTTAACCGCATTCC
AGTGGTTTTCCTGGATTAGCCAGAAATTGACTGACTTCACGTAGAAAATAGGCTAGGTCTGGTCTAGTTCCCATCATCAGGTACATGAAGCTACCGACTG
CCTCTCTGTTCGGGATCGCCGTCATCTCATCGTGTTCTGAAGGGGTTTGTGGGCACATATCTAGAGAGGGTTTGATACTCCTATCTGTGGGTGTTTCCAC
TGGATATGAGTTCAGATGAGAAAAGCAGTCCAGGACTTTGGTAGCGTATTTTTCTTGGTGTATGAGATGGAGCGAATTTTACGATCGCGCGGGTAGAAAA
GTTTTCGCCCACCTGATACATTTCTCTGTACAGTAACTTCAACATGATGGTGAAGGCCGAGTTCATCACCTCGCTGCTTCCACGACAGCCACCCAACCTG
TTTTCCCCTCTGGGATCGCTTTGGTATGATTGGTGAGATCCTGTAAGATTCCGTCAACAACAAGCGTCTAGAGCATCATTTCTACCAATCAATTGATTTG
GTTTACAGATATCCATTTTTGTTTTGCCCATGGTGCACGATCTCGCTTTGCTCAGTTAGAATTGCGCCATGAGACGCGCAGGAACCCGTCCATACTCGCA
AGACTTACGAGAGCGCGTTGAGTGATGAAGTCGATGAAACTTTCTCGCCCAAGTGTATAGCGGTAGCCTAGACTTAGTCCTGAAACTTAAGCCTGGGGGG
TGTAAACCCTGAACGCAGTTCCTTGAAACCGTGATTCAGAGTGGCGTGGCACCTTGTGTAATCCCTATCGGCGTCGATTGCTTCGGGGGAAGCCCGGATA
TATCACCACAATGAGTTGTCAAATACAAATAGGCCTTGAAAATGCTGAGCGTAACGTCCACTTCCTGAACGCACTTCTCCAATGTCTGGAACCGGTATCG
AGAACTCGGAACAAACACCACTTTCAGATACCCAATACAAATACAGAGTTATATACAACACACAGCCGTTACTTATTCTTATAGACCCTTGAACGGTGGG
TCTGAACACCAGTCAACTAAGGCTGAATCCAGGATACTGGTCAATCCTGAAGCCTTTTCTTCACACGCGCACCACCCTCAGATGAGGGAAATAATACACA
CCAATACAATCCTATCTCAAACGCAGTCTATCAAATATTCCTGGGGATGACTGCTACTATCACCCAAGAAGGCCTTGTTAATATGAAATGAAAACCCCGC
CCTTACCGTACGCGCAGCGGGTCCAACTAATAAAGGGAATGCAAGGATCACGTCAAATACTTACGTGAATGATCCCCTCGCAACTGGGCTTGAATCTTGT
AGAGAGCCCCGCACCGAACTGCCCTTAACTGAACGGCGGACCCGTGTCCTGCTTGTCAGAAGCTCACTTACTTTGAGCGACTTGCGTAGTAGGGGGTTAA
ACGAACTCTGATTGTTATCTTTGCTAGCCGATCGCTAGCTTCTTCGTAAAGGGTATCTGTCTGTCTTCGTTCTTCTGTGTTCTTCTGTGTTCTTCCTGGC
GACCTTCTGACTTTGACTTGACTTGAGTATACTGGCTGTCACTTCGTGGGTTCACTTTCCATCTTCAAGGAGTCAAATCCTCGCATTGGGTTCTGGGTTG
TCTGAACGTGGGTTCTTCAAACCTACTTTCAAGTTACTTGACCTTGAACATCATTTTCAGGTTCCAATTTCTTGAACGTAGATACTTCAAACTCACGCTC
AGGGTTCTTCAACTTGGACATTTAGCTGAAACCAGTGTGTACGACCTCACAGTACAGGATAGTCTTGAGCACGTATAATACATGCGTTCAGACATCCGCG
TTCAGACATCTGCGTTCAGACATCTGCGTTCAGACATCTAATGTGATCAAGGTCTCATGACCAAAATCATACTTCATTGTGAGTGTCCACACGGCATTTC
TTCAACGGGCTTTTTGTTTGTCTGGCGTCTGGTGACTTACGGTGCACTCCGGGTACACGGACATTCACACGCTCAGGCTTTAGGCAAGGCGGGACACCAT
ATGTGATACATTCACATAGGCATTTTCAACTCCATTGGGTTAACCCGCTTAAGGACGGGGTTGAT