Description :
From Genome Similarity Track
Location :
contig_8:811852- 813360
Transcript NameFunction/comments
g2102.t1hypothetical protein

Sequence
1508 bases(100 bases per row)
ACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAG
TTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGC
TTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGG
CTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCT
ACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAGTTTACTTAAGTTCAGTATACT
TGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAA
ACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTC
ATATGCCTCTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTAG
CCCCGCTACATGTTTGTGGTTCTGTGGGCTTTGTGTACGTTGCAAAGCGGAAGGACAAATTATGTCCCAAGGCGGAACCAGCTTTACTACTGGGGTTCGC
CCGCTCGACAACTGGATATCGTTTGCTTCATTTGCGAACTGGAAAGATTGTCGAGGCTCGTGACGTGAAGTTTTGCGAGGACATCACAGTAAGCAGGAAG
TACATTTCGGCGCTGTTGATGGGGAAAAGCGGAGGAGAAAAGATTCCGTTTGTGCCATTGCCGGTGGAGTATGTGGCAGAAGAAAGCGTAAGAACTGGAA
CCGGAGAATCCGTGAAGAGTTCGCTGTCTGTGGATCGAAGTTGTTCATGGACAATCAAAGCGCCCTGAAGGTGTGCAAGACTGTGGGGAACTACGAAGGC
GTCAAGCGTTATGCTAAGATCAGTCACAAGATTGCAGAACTTGTGGACGCCAAGGAGTTGGTCCTTGGGACGCACAAGTTGAAGGCGACGGGGCGCTCAT
TGAGCACCGAGCGATACGGACCCAACCCTCATCGTGGCTTGGTCGTGCCGTGCCGCCCCTTGCGTGTTTTGTGTGTGCTCGTCTTGTAACCGGTGGAGTC
TTCTTCGCATGGCGGCGGGGGCTGGAATAAAAAAGAAAAGTGGAAGAAATGTGGGTGCTTTTCTGGCCAATAGGAGATCCGAATTTGGACAACGTTAATA
AAAAACAA