Description :
From Genome Similarity Track
Location :
contig_8:811822- 813330
Transcript NameFunction/comments
g1955.t1hypothetical protein

Sequence
1508 bases(100 bases per row)
GCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCG
ATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACAT
CGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTT
GCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGAC
GGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAGTTTACT
TAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATG
GGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGT
TACTTTCTACCAGTCATATGCCTCTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGAGGT
GAACCGAATGTGTAGCCCCGCTACATGTTTGTGGTTCTGTGGGCTTTGTGTACGTTGCAAAGCGGAAGGACAAATTATGTCCCAAGGCGGAACCAGCTTT
ACTACTGGGGTTCGCCCGCTCGACAACTGGATATCGTTTGCTTCATTTGCGAACTGGAAAGATTGTCGAGGCTCGTGACGTGAAGTTTTGCGAGGACATC
ACAGTAAGCAGGAAGTACATTTCGGCGCTGTTGATGGGGAAAAGCGGAGGAGAAAAGATTCCGTTTGTGCCATTGCCGGTGGAGTATGTGGCAGAAGAAA
GCGTAAGAACTGGAACCGGAGAATCCGTGAAGAGTTCGCTGTCTGTGGATCGAAGTTGTTCATGGACAATCAAAGCGCCCTGAAGGTGTGCAAGACTGTG
GGGAACTACGAAGGCGTCAAGCGTTATGCTAAGATCAGTCACAAGATTGCAGAACTTGTGGACGCCAAGGAGTTGGTCCTTGGGACGCACAAGTTGAAGG
CGACGGGGCGCTCATTGAGCACCGAGCGATACGGACCCAACCCTCATCGTGGCTTGGTCGTGCCGTGCCGCCCCTTGCGTGTTTTGTGTGTGCTCGTCTT
GTAACCGGTGGAGTCTTCTTCGCATGGCGGCGGGGGCTGGAATAAAAAAGAAAAGTGGAAGAAATGTGGGTGCTTTTCTGGCCAATAGGAGATCCGAATT
TGGACAAC