Description :
From Genome Similarity Track
Location :
Scaffold_71:81182- 82705
Transcript NameFunction/comments
Phymu_g3429hypothetical protein PHYSODRAFT_258618

Sequence
1523 bases(100 bases per row)
TAGCCGCTGTGAGCAGCCGTGTAATTATAGTACACGGTGTTTTCAAACTCGGGCGTGCAGAAGGGAAACTCCGCGCTGTCGCTGGGGAAGAAAAGATTTT
CGCCCGACGTGTATGTCACGTAGCAACCAAGACAGAAGCACACCACCGTGACGATTACAGACATAATCTTCTCCCAAATCGGCATCACCGTCcactgcat
cttcatcaagaacACGATCGGCAATATGATCGAGTGCATCGTGATGCATGATGCACCGACGAAGTCGGACAAGTCGATAAAGTGGTCCTTCAAAATCACT
GAGGCAACGACTAAAATTGCGACGATTGCAATCCTCAGGATGACGTACTTGATAGCGTTCGCCCCTCGGTACTCAGCGGCCTCAGCCTCGGGATGCCCAA
GGTGGACATTTTCGTTATCAGCGACAGAGATGAAAGACTGCTTCGAGGTACGAGCTTTCTCCAGGATGTTGGCACCGTCGGTTGGCGTCCCAATCTCCGC
GTAGGTCTGCAAGTTGTTTTCGACATCATCCGCCGTTGGCTTGTGCATTCCAAGGAACAGGCGCTCGGTGATGTAGAATGCCGGATTCAGGATGATGGAG
AACGCGATTGTAATGTGCAGCTGCATGAACATGTACGCGAGGACAACAGCACCCCAGTCAGAGGCGAAGCCAAGCGTAGTCAGACCCGTTTCCGAGTCGG
GGTAAATGGACCACAGCAAGTTGCCGGAGATTTGGCACCCAACTGACGAGTACGCTGTGCTGGCCAAAaccaggaagcagcacgtcgtgAAGGCCATTGT
GACGAATACGACGCGGGGCATACGAGTGGGGTCACTGTGCTGACGCTGAAGGGCTGGAATCACGATACCAGCGCCATAAGCCAGCGCCAGGTTTCCGAAG
GCGCCAGCGACTTGCTTGAAGTTAAGATCCGGGGAAGGCGCAGTTGGGTGTCCGCGCATGCCGTACATGACAACCGCAATGCCAATAACATCCGCAACGA
GCGTCCCCATGCAACCTGCGAAGGCAGCACCAGCCCCTTCCTTGAGCGTCGGCACCAAACACACTGGCAGTACCAGGAGTGCCATCAGGATGGACCACGT
CGTTGTGCTGAAAGCATTAGGGTAGAGGCCGTCGAGAAGCGTTCCGCCAAGAACCAGGAAGGCGCAGGGCACGATGAGGCAGTTGCCCATTTGAGCAATA
ACCGTGAGGTATCGGCCCCACTTGCCCATGACCCACTCACCCAGGTCACCATAAGTCCTGACGGACGTGGGAGCGAGGAGCATGACGCGGCAGATAGCCA
CAGAGCCGTAGATGTTGGCGAAGGCCATGAAAGCCATAGCGACGATCGCGAGAGCTGGGCCAGCGCGCGAGAAGTTCCCTGGCATGCCGAGAGTGCCGAT
GCCGTAGACACAGCAGAAGAGGTTGAAGGCCGCCTTGGCATCCTCCATCGTGAAGAACGGCTTCCCCATTGCGAAGTCCGAGTTGCTACAGTGGGTCGGT
GCGTGGTAAATTGAAAACTGAGC