Description :
From Genome Similarity Track
Location :
Scaffold_151:81156- 83826
Sequence
2670 bases(100 bases per row)
TGCGGCTTAAGGAGGCCAACGTAAAACACGGGGGGGGTACACAATTTGCGCGGTGAGTTGAGCTTATACTCAAGACCTTTCTTGGCCACGACCGCAAATA
GTCCAATGAAGCGAGGACGCAGCTTCGTCTTAAACACAGCAGACACTACATTGTAGGCAGCTTCTTAGCGTTTAGCAAGGCTTGGTTACCGACCTCATAA
CTTTCAATACAGCTTCTGCCTTTATCATCTGCTTGTTCCTTCTGTTTGTCTTGGATATTAGCCATTGCATCACGCACATGTTGTAAGACATTCAATCGTG
TTGTAAGGAACGCGCTAACCTGTTTTTGAGCAGTAGAAGGGCTGATATCAGCAAGTCGATCGGGTACTTCTCTCCCACCAAGCCCTGATCCACGTAGTAA
TAGCGTTAACGGGGCGCGGGTGTGTGAGGCCGTCCACGTAGAAAGGAGTATAGCCTGTCGAGGCATGGACGGCATTGTCCATATCAAACTCAACAACGGG
GAGCATTTAGCTCCAACTCTGAGGTGTCTCAGCGCACACGCTGCGTAAGACGTCACTGAGGACGCGATTGACACGCTCAGTCTGACCATCGGTCTGCGGA
TGATCCGTGGTAGACATGTCTAATCTGGTGCCGAGCACCTTGAAGATGGCCTTTCAGAACTTGCCTGTAAAACGAGGATTGCGGTCAGAGACAATTTCCC
ATGTTGGCGAAACACGCGATCAATGAACAGCAAAGCTGTACCTTCACCATCAATAGAGTCCGGCACAGCCGCTAAGTTAGCCATTTTGCTCAAACGATCG
ACAAAGACCACAATACCTGTGTTGCCATTCGAATCCTTCGGTAGGCCAAACACGAAGTCCATGCTGATGGATTCCCAACACCCATAGGGTACAGGCAAAC
TAGCCAGCGGCGCAGTCACATGTGCCGAGGGTTTGACCCGTTTGAACGTCTCACATGTGCGCACGTAAACGCTAACCCATTTATCGAGTTGGGCAACCAA
TTAGTCTGGCTAACCAAGCCGTGGATCTTCTTACGACCAAGATGACCGCTAATAGCTGTGTCATGGACCTCATAGAGGATACGATACTTCAGTTCCTCAT
CATGAGGAATAATGATACGCGGGGTATCCGCGGCATCCGTGCGATAGCACAACAAGATGTTATCGATAGAATATCAATGTAGCCTCGCACGCGAACGTGC
CGAAAATTTAATGTCCGAGTCCTAAAATTCATCGCTTCCAAGAGCACGTAGCAAAGCTATACATTGTTCATCCTTGGCATAAGAGGCACGGATTAAGTCA
GTAATTGACGACGACAAAATCGTAACGTGAGCAAGCCCATAGTCGCGCCGTCGTGACAGCGCATCAGCCAGCGTAATTTTCTTTCCCGTCTTTTACTTCA
CCTCGAAGTTATATTCTGCAAAGAATGAAAGCCAACGAGCCATTCTCTACGAGAGGTGAGGCGATTGGGTCGCCGTGCGTAAGGACGCATGCTCGGTATA
GACTACAAAAGACTTAGAGCCAAGCAGATGAGCTCTAAATTTGACTAGAGCATACTTCATAGCAAGTAGCTCTTTGTCGTGAACTGGATAGTTCTTTTCA
GCAGCTTTAATCTGACGGGGTTCAAAAGAGATGACACGCTCGCGTCCCTCAACATCTGTTTTTAACAGAGCACAGCCAATGGCAAAATCCGAAGCGTCAC
AGACGAAACTGAAAGGCCGATCAAAATCTGGGAAAGCCAAAATCAGGGCATGTAGGATACTCTCCTTTACGGCCTTAAAAGACTCTGCTTCAGTGCTAGT
TCAGCACCACTCCACATCCTTTTTAAGGAGATTGTATAATGGCCGAGTCATATCAGCGTAATTTTTGCTATACTTGTGCAAGTAATTGGCAAGGCCAACC
CATTGCGCAGGTCTTTTTAATTCTTAGGAGCTGGCCAATCCACTATGGCGTCCACCTTTGCAGTATCTGCCCGAATGCCTCGCTTCCCGATGAAACATCC
CAAAAATGGGATCTCATTCGCACCAAAGATACATTTCGATGCATTAGCATAGAGCTTATTAGTGCGCATGCACCCGAGCACAGCTCTTAAATGATCGATG
TGGTTATCCACGTCCGACCGACCCTGTTCCGCCCGACTATGGACAAATATGTTATCAAAATATGTTTGTGCATACGCACAGTGAGGGCGGAACAATTGCG
TCACCAGACGATTAAACGTAGCCGGGGCATTGAAAATTCCCTGGGGCATGACCAGCCACTCCCAAAGCATACCGCTTGGAGTACTAACCGCTGTAAGCGG
GATATCACTTGCTCGCATGAACAGCTGGTAATAACCATTGACTAAGTCGAGTGCACTGTACATTGTACATCCTGCCATGTTATTCTGAATAAAGTCCTTT
CTAGGAATGGGTGTTTGTGCCGGTATAGTAGCCGCATTAAGCTTATTATAAGCGTGCACAATACGCCAACTACCATTAGGTTTTTTGACACAAAATGTCG
GTGTGAAATGAGGATAATTACTCTCCCGCACCATTCCCGCCGCGTGCTTAGCACTAAAAAACTCGTCAATGACGTCACATTGTTCCTTTGGTAAAGGCCA
CAGCCTTATAACAGTATTTGGTTCCAAGAACCAACTCAATTTCATGACGTACGCCCCTATCGGGAGGTAA