Description :
From Genome Similarity Track
Location :
Scaffold_754:8115- 13562
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_754-abinit-gene-0.11Chromosome-associated kinesin KIF4

Sequence
5447 bases(100 bases per row)
CTGTCTTTCGCTTTAGCACGCTGTTCTGTTTGCTGTGAAGAGCAGTCAGCTTCTGTATCTCGTACTGCTTGCGCTGATCCTGACGCTTCAGCTGCAAAAT
CTTGAGATCTTGCTCGCGCTTCTCCCGGCGGTGCGTCTCTGCTTCCGCTCTGAGTTTGCGCTGAAGACCTGCCTTTTGCTTCTTCATGTCAACGATTTCC
TGCTCGAGTGTTGAGATCTTGAACTTGCCAGTCTTCCACAACGCTGTTAGCCGCTTGCACTCACTTTCGGCCTGCTTGGCGACTTGGAGTTGGTTTCGGA
TCGTTTGCAGCCGGACGCGAACATCCTCCTTGCTCTTGTGATCCACTGCATTAGCGCTTTCTCCATTCATTTTGATTTCGAGTGACAGACGCTTCTTCTC
CGCCGTCAGTCTACCGACTCGATTCTCTAGCTGGATGATCTTTTGCTCGTAGGAAGTCGTGAGGCTTGCAAGGCGAGCTTCTGTGGCTGAAGAAGACGGC
AACGCTGACAACTCCTGCATGATCTTTTCTTTCTCCACAATCACGTCCGAGAGATTGTCCAAGTCGGCTTGCAATTGACTCGGTGCAGATGGAGAAGAAA
AAGTCTCAGCAGGAGAAGCGGAGGCTGAGATCTTGATTTGAATCGCCTTCTCGAATTCCATAGCTTCGAGTGCCAACATTTTCGTTGGAGACACTAAGCT
GGAGGCGGATCCTGCGGCTCTGGCTCCACCAAATCCAGACGATGATGACGACGCTGGCGTCAGACTCTTTTTCGTAGACATGAACTCGTCAGCGACTTTC
TTCCATTTGTCTTTCGCGCTCATGACGATTCGCAGCTCCTCTTCACGCGTGCGAGCAACGTCCTTCCACTTCTGCAGCTCCGCTTCCAAATCGGCAACAC
CAGCGTTCAGCGATGTACTACCGCTCGCACCTGCAGCAACTCGGGCTCGCGGCTGGTGGGACTTTGACTGCTGCTGGAAAAGTTGGAGCTGGAGCAACTC
GAGCTGCTGCTTGAGGTACGCGACTTCGTTCGCTGCGCTCATCTCCTTGTTCACGATCGCGTTGTTCTGGATGTTCCGCGCGCGTGATGCGTATCGAAGT
GTGTTGGAGGTCTCCTCAAAGTTTATATCCGCAGGACTGATGCACGCGATCATCAACGTTTTGCTGTTTCCTCCGAGACTGTCCTGCAGCAAGCGCGTGA
GCTTCGAGTCACGGTACGGCACGTGCGATGACGACGAGTTCGAGCGGCTTCGCTCGCAGAGTGCGTTGATGACGTTGCCGAGCGACAAGAGACCGCGGTT
GATGTTGACGCCTTCTTTGAATCGTGCGCCCTCAGCATTCGTTCGCTTGGCGCGCTCTGAGCCTGCGAGATCAACGAGGTGAAACTTGGAGAAACGCGCT
TCGACACCTTCGCTGACAGTGTCAAACTGCTCCATCGTCAGTGTGCAGATCGCGTGTGAGCGACTGGACTGCGCATTCATGGTTGTGAACGCAGTAGCTC
GATGCAGAGCGCCAGCATGGAGCAGAGAGGCAACCTGGGCGATCGACTCAACGCTGTGCTCGCTCAGCCCCGCGACCACAATACCCCGCTTGCCCTCATC
GCGCACAGAAAGACCAAGTGTCGAGGCGCTCGCACTGCCGCTGTTGGACGCGCCGGATAGCAGGTCGTAGATTTCTTCATTGAGAATCTGTAGATAGTCG
CAGTTGAGCACATCCATCCATTGTTATGTACTCGTGAATAAACGCATTGCGACAGCCCATACACACACAAGTAGATTGAACCATTACCTCCAAGTAGGAT
ACTTTGACCGCAACCTTCTTGTCTTCTGGAGCAGCCTGGACGCGCTTGAAGATCTACAAAACACAAAGGCAAGGCTCGTTGTGGTCTACTGAGCTTGATA
AGTTGGTCATATAGAAATTAACACATCGTACGTCGTCCATGGCTCGCGGGATGATGCCGCGATCTTCAGGCGCGATGCTCAGTTTGAACTCGTTCCCCAT
CGTAAACCTACGCAATAAGAACCACACCAAGCGTTAACCTTCCATGACACCCAGCATGACCATCTCTATACAAACGCACACATGTACACACATGTAGGAC
AATGTATCAAACTAATCACACTTACGTCTTTCCGGACCCTGTCTGGCCGTAGGCGAACACCGTGGCGTTGTACCCATCGAAGAAGCGGTCAATCAGCGGC
GCGACCAGCTGCTCGTACACTTGCTGCTGCTGCACTTGCGGCGCGAACGCGGCGTCAAAGTCGAACTGCTTGCCCGCGCTGCCGCCCAGCACCACGCGCG
CGCCGCCGACCGCCTGGACGCACGCCTCGCTCGCCTGCGCTTCTTCGCTCGCGCTCAGCGGTCGCACGCGCACGGCGACCTGAACACTACTGCTGTTGCT
GTTGCTGTTGTTGTTGGGCTTGGCGTCGGGGCTGCTGGAGGAGACGCTCGCGGGTCCGTGAGGCTCCGNNNNNNNNNNNNNNTCCATGGCGATGGCTCTT
GCGTGAATGCGAAATGGATCAGGTTTTCAAATAGCGCGCGCTTTTCAAGAATTGGAGAAAAAAAGGGTTTGGCCATCATCTTGATAAAAACCGCCTAGGG
TTTGGCCCGTAGGGTTTAAAACGTTTTTAAAAGAGGGTCAATATCGATACATTCGCTCCCTAATTGGCTTCCGTCAGGCCCGTTATCCGTTATCACGCAT
TTGTATGGGCTTCCCTGTGCGAATATCAGAACCATGGATCAGCAGCGGTGCTCGCCGGACGAAGCTGGTCGGGGCTGTCGAACGCCTGGTCGAGGGAGGG
ACTAGGAGCCCACTTGACCCCACTACTCGCGCGATCTCCAGCACCTGCGGCGCTCTCCGTGAAGTCCACACTCGGAAAGTCCATCGCTGGAGGTGAGAAC
GCGCTGTCCGAGTTTGGATTCCCAGCGCGCATCGCAGGGTAGTCGGAGTGGGAATCGGTGCGTGACATTTGCGAATTGCCCATGGCCACCATCATGGAAG
GATCGCTGGTGGCGATCTGGAGCTGGTGGCTCTCGCAGAATGCGGTCAGCGCGTCTTGTGGGGCTTTCGAGAACTCGTGGATGTTGGCGCTGGTCGAGCG
TAGCTCCAGAGCACCCGACCAGTGGCTCTGCACGGAGGCGGCCGGGGAAGTCCCACTGTTGCCTCCAAGCGAAGACGCTAGACTCGCACTGCAGGTGAGG
GTCATCGACGCAGCGACAAACTCGTCCCATCTCGTCTCCGTCAGGAACGCAATCTAAAAACACAAAAGAAAAGCCAAAATCAGTTGGGAGCTATCCCACA
TCATAGTAGGCATCTGAGTGGCTCACGTGGATTTGAATCGGAGTGTCGATCAACAGGTCGCGGATGATCACCACTCGAGCGTTGCAATGCTTCACCAGGC
GCTGGCAGAATGAGAGCACTTTGGCTCCATAGCCATCGCCGCCACTTCCGGCAACCGACTGGATCGGAAACAGGCAACTCGCTTCTGTTCTGTGACAATA
ACACGTTGTTGAGAAATCACAAAGTTAGCTTTTGTGGTCCCATTAAGCTATTTGACTATCCCACTCGCTCACCCCTGCCAGCAGCGCTGGAAGAACGCCC
CCGTGGCAAACTGCTGCTTTGGGAGTCGAAAGAGCGCGTCAAAGCGCACCACAAACTTCTCCGAGGGACTCAGTCGGATCGGCAGCACCTGCGCCGGATC
GTCNNNNNNNNNNNNNNNNNNNNNNNNACGCGTCGATCTCGTTGAACACGACCTGGAAAAAGAACTGCGCCTGCGTGAATTTCTGCAACTGGAAACGCTT
TTCGCCCTTGAAAACCCCGAAACTGGGCAAATTCCCGCTCGCACTGCCTCCCTGCAGTAGGCGGAGCTTCAGATCGTTCGAGCCATCGACGCACTTGATG
GAGCCAAGTGGACGGATGTGGATTTCAAAGTCGCTCAGCGAGAGGTTCGTGAGGTTGCAGCAGCTCACGCAAAGTGTCACGACCTCTTCGTGGCCTGGGA
GCGGCTGCTTGTACGACACCCGGAGTGAAAATGGGTCCGAGCTCCCTGTGACCACGACCCCACCACTGTCAGTACTGTCTTGCTGTCCAAAGTCAGTCAA
GTCCGGTGATACTGGAGAGCCAGACGCCAGCGACTCCTGGTGCTTCCGAGGCGTGAACAAGTGCGCTGGATGGAACATTTCCTGCGAGTACAGACTCTTT
CCATCGAGTCCAGACATTGTCAAGTGCTCCTGCAGTCTGAAGGGTATACATAAAGAGTCAAATTAGCCAGCTCCACGCGCAAGCACAATTAATTCGAAAC
AACAGCCCACTCACGCGTGGTTCTCAAGTGATGCAGTCGACGTGGTGACCGCGACAAACTGCTTCAACTGCTCGTACTGCTGCTGGATCTGCGGCGCCAG
CTGTGGCTGCAACTGCGCGATCATCTTCATGCAATCGACGACAGCGACGAGCGCCTCAATGCCGACTTGGAGCTTGGAGCGACTCCCATACCCAGTAGCA
GCTCTAGCCCCAATCCTCCCTCCTCCAAGTTTCCCGTCGTCAAAAGTAGTGCTTGGGTCGCTCGCCTTACTTAATGATGAAGACTCGCCTGATGATTCGC
TCTCGTGCTGTCCACCAGTGAACAATTCCTGGATCTCGAACCGGAGCTGCTCGCAAAGCCTCTCGAGCGGCACCACCTGGAAACTTGCAGCCAGTTGGAT
CCCGACCCAGATGAGCTGCACACGCACCTCAGACGGCGCAATCTGGCGCCACACGCGCTGGATGTCGCTCTGGAAGAACTGGAGCGACTCGCGGAACAGC
AATGTGCTCGAGCAGTGCAGCGCGTTCTGGTAGTGGCGCGTCAGCAGCGCCATGTAGCAGACTTGGTTGTTCTGGAACAACGGCACATTGGTGGCACTGG
GTGTTTTAGAAAGCAACAAGCCCTGGAAAGCCTTGAGAACGATCAGTTGCGCGACCTGGAGGTACTTGGCTGTCATCGTCGGTTGCTCGCTGTGTGAACG
ATGGAGACTCAGTGCTTGTACGAGACAGCGGAAGACCTGGGAGCCATTCGCACGCGGGGAGAGCCTGGAGTTTCCCTGCGGCTGGCGGAAGAACTCGAGC
GCACACAGCGACTCGAGCATCAGGAACTCCTGCTTCTGTACGACGCGGTCACAAACCGAGTCCATGAGCAGCTGAATGAGCCCCTGACGATCACTAAGGA
ACACAATAGACAGACAACACACACATCAGAGATGACACAGGCACAGGGATCTCTCAGTTTTTACGTACGTCTCACGCTCCATGAGGCTCAGCGCCTCAAC
AACGCGCACAAAGAGCTGCAAGCAGCTGGACGCCGACACCCACGCGAAGGTTTTCACGAGCATCTGGCTCATCTCGAGCTTGAACTCGGAGCTCTTGTGG
TAAAAGCACTGCGCGATGAGCTCCGGCACGAGCGCCGGCGCGCGCTT